View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14306_low_8 (Length: 218)
Name: NF14306_low_8
Description: NF14306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14306_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 44 - 207
Target Start/End: Complemental strand, 32703991 - 32703828
Alignment:
| Q |
44 |
gtgtaagactgaactttcaggctggcatgactgcagctcatggaattcttggagagtgttgtacccttaagaccaaccctaaacacatggtaccttcttg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32703991 |
gtgtaagactgaactttcaggctggcatgactgcagctcatggaattcttggagactgttgtacccttaagaccaaccctaaacacatggtaccttcttg |
32703892 |
T |
|
| Q |
144 |
gaaagaacttggagcacgcatctttgtaactagattcctgagttcctttattaccacaggttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32703891 |
gaaagaacttggagcacgcatctttgtaactagattcctgagttcctttattaccactggttct |
32703828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University