View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_1 (Length: 860)
Name: NF14307_high_1
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 712; Significance: 0; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 712; E-Value: 0
Query Start/End: Original strand, 17 - 847
Target Start/End: Complemental strand, 49701568 - 49700736
Alignment:
| Q |
17 |
atgaagaacaagttcattccgtcccaaaacaaaattcttctgtgtttaagttattagacttacatgttctactccattcacccgtttgataagttcctgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49701568 |
atgaagaacaagttcattccgtcccaaaacaaaattcttctgtgtttaagttattagacttacatgttctactccattcacccgtttgataagttcctgt |
49701469 |
T |
 |
| Q |
117 |
tactcaaaagaaaaaggaaggttcagtttgcattttccccctatattatagaaaaagacatttgagaaatacaaattgtgtatacgttcaaaggaaaatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49701468 |
aactcaaaagaaaaaggaaggttcagtttgcattttccccctatattatagaaaaagacatttgagaaatacaaattgtgtatacgttcaaaggaaaatt |
49701369 |
T |
 |
| Q |
217 |
aaacacagccacaataaaatgcagatttttaaattacttaacttcacttgcaacatgactcctttcttatgttgttatcctcaatgttcaaatatcacgt |
316 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49701368 |
aatcacagccacaataaaatgcagatttttaaattacttaacttcacttgaaacatgactcctttcttatgttgttatcctcaatgttcaaatatcacgt |
49701269 |
T |
 |
| Q |
317 |
cgaattatgactaactcaagtcaatggatgggataaaactctcctgacaattannnnnnnncattcttgaaactcaaattaatttgccacattacttaac |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49701268 |
cgaattatgactaactcaagtcaatggatgggataaaactctcctgacaattattttttttcattcttgaaactcaaattaatttgccacattacttaac |
49701169 |
T |
 |
| Q |
417 |
aaaagnnnnnnnnnnnn-gaagaagccaaactagcccaccaaaattggcaccggggagaattcat-acttaagaaaatttaaacagtagaacttctgaaa |
514 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49701168 |
aaaagtttttttttttttgaagaagccaaactagcccaccaaaattggcaccggggagaattcattacttaagaaaatttaaacagtagaacttctgaaa |
49701069 |
T |
 |
| Q |
515 |
aattgaaatgcataagctaatttcaaaatattattttaaaaactaatagtcagtttggagtttgatgttggtgaagtctacatcagtgtgatagaaactg |
614 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49701068 |
aattgaaatgcataagctaatttcaaaatattattttaaaaactaatagtcagtgtggagtttgatgttggtgaagtctacatcagtgtgatagaaactg |
49700969 |
T |
 |
| Q |
615 |
cttaactagtataactaaattgaaagcannnnnnncttcataaaagcagtaatgaatgatgtataaaacagctttaattggaaacatatcttatcaaaaa |
714 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49700968 |
cttaactagtataactaaattgaaagcatttttttcttcataaaagcagtaatgaatgatgtataaaacagctttaattggaaacatatcttatcaaaaa |
49700869 |
T |
 |
| Q |
715 |
ataaaatgaagtaagagattaatggggtatagtttcttaccgcggcaccggtgacaaaaacataaaagtctgttggtgcttcattatccaaaatcacatc |
814 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49700868 |
ataaaatgaagtaagagattaatggggtatagtttcctaccgcggcaccggtgacaaaaatataaaagtctgttggtgcttcattatccaaaatcacatc |
49700769 |
T |
 |
| Q |
815 |
ttcctttggaggaaaatactccgccttcatctc |
847 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49700768 |
ttcctttggaggaaaatactccgccttcatctc |
49700736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 44745943 - 44745985
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
44745943 |
gaagaagccaaactagcctaccaaaattggcactggggagaat |
44745985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 435 - 476
Target Start/End: Original strand, 30852117 - 30852158
Alignment:
| Q |
435 |
aagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
30852117 |
aagaagctaaactagcccaccaaaattggtaccggggagaat |
30852158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 472
Target Start/End: Complemental strand, 12761627 - 12761589
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccgggga |
472 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12761627 |
gaagaagcaaaactagcccacctaaattggcaccgggga |
12761589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 43303872 - 43303830
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
43303872 |
gaagaagccaaactagcccaccgatattagcaccggggagaat |
43303830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 6127948 - 6127990
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6127948 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
6127990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 776 - 843
Target Start/End: Original strand, 2242434 - 2242501
Alignment:
| Q |
776 |
ataaaagtctgttggtgcttcattatccaaaatcacatcttcctttggaggaaaatactccgccttca |
843 |
Q |
| |
|
||||||||||||||||| |||||| | ||| | ||||||||||||||||||||| |||| ||||||| |
|
|
| T |
2242434 |
ataaaagtctgttggtgattcattctgcaagactacatcttcctttggaggaaaaaactcagccttca |
2242501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 438 - 476
Target Start/End: Complemental strand, 34228984 - 34228946
Alignment:
| Q |
438 |
aagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34228984 |
aagccaaactagcccaccaaaattggcaccggagagaat |
34228946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 36428827 - 36428785
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
36428827 |
gaagaagcaaaactagcccacccaaattggcaccggggagaat |
36428785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 438 - 477
Target Start/End: Original strand, 44486123 - 44486162
Alignment:
| Q |
438 |
aagccaaactagcccaccaaaattggcaccggggagaatt |
477 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
44486123 |
aagccaaactaacccaccgaaattggcaccggggagaatt |
44486162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 31605809 - 31605851
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
||||| || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
31605809 |
gaagaggctaaactagcccacccaaattggcaccggggagaat |
31605851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000005; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 435 - 476
Target Start/End: Original strand, 25414177 - 25414218
Alignment:
| Q |
435 |
aagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25414177 |
aagaagccaaactaacccaccaaaattggcaccggggagaat |
25414218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 435 - 476
Target Start/End: Original strand, 55256161 - 55256202
Alignment:
| Q |
435 |
aagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55256161 |
aagaagccaaactagcccaccaaaattggcaccgaggagaat |
55256202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 33867417 - 33867375
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33867417 |
gaagaaaccaaactagcccaccgaaattggcaccggggagaat |
33867375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 435 - 476
Target Start/End: Complemental strand, 46295211 - 46295170
Alignment:
| Q |
435 |
aagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
46295211 |
aagaagctaaactagcccacccaaattggcaccggggagaat |
46295170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 2732109 - 2732067
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
2732109 |
gaagaagctaaactagcccacccaaattggcaccggagagaat |
2732067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 26356932 - 26356890
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
26356932 |
gaagaagctaaactagcccacctaaattggcactggggagaat |
26356890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 435 - 475
Target Start/End: Complemental strand, 3078647 - 3078607
Alignment:
| Q |
435 |
aagaagccaaactagcccaccaaaattggcaccggggagaa |
475 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3078647 |
aagaagctaaactagcccaccaaaattggcaccggggagaa |
3078607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 434 - 477
Target Start/End: Original strand, 27557605 - 27557648
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaatt |
477 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
27557605 |
gaagaagccaaactaccccaccgaaattggcaccggggagaatt |
27557648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 11793482 - 11793524
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| ||||| |
|
|
| T |
11793482 |
gaagaagctaaactagcccacccaaattggcaccgggaagaat |
11793524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 472
Target Start/End: Original strand, 35475542 - 35475575
Alignment:
| Q |
439 |
agccaaactagcccaccaaaattggcaccgggga |
472 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
35475542 |
agccaaactagcccaccgaaattggcaccgggga |
35475575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 434 - 477
Target Start/End: Original strand, 48125136 - 48125179
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaatt |
477 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
48125136 |
gaagaagccaaactagcccaccgaaattggcaccggggaaaatt |
48125179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 437 - 476
Target Start/End: Original strand, 38374563 - 38374602
Alignment:
| Q |
437 |
gaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
38374563 |
gaagctaaactagcccacctaaattggcaccggggagaat |
38374602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 45559306 - 45559264
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
45559306 |
gaagaagtcaaattaacccaccaaaattggcaccggggagaat |
45559264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000003; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 21213884 - 21213842
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
21213884 |
gaagaagcaaaactagcccacctaaattggcaccggggagaat |
21213842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 437 - 476
Target Start/End: Original strand, 27967113 - 27967152
Alignment:
| Q |
437 |
gaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
27967113 |
gaagccaaactaacccaccaaaattgccaccggggagaat |
27967152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 6099480 - 6099522
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||| |
|
|
| T |
6099480 |
gaagaagccaaactagcccaccgatattggcagcggggagaat |
6099522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 472
Target Start/End: Original strand, 41908599 - 41908637
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccgggga |
472 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
41908599 |
gaagaagctaaactagcccacccaaattggcaccgggga |
41908637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 435 - 476
Target Start/End: Complemental strand, 32106680 - 32106639
Alignment:
| Q |
435 |
aagaagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
32106680 |
aagaagccaaactagcccactgaaattggcaccggagagaat |
32106639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.000000001; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 434 - 475
Target Start/End: Complemental strand, 23242101 - 23242060
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccggggagaa |
475 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
23242101 |
gaagaagctaaactagcccacccaaattggcaccggggagaa |
23242060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 438 - 476
Target Start/End: Complemental strand, 3869806 - 3869768
Alignment:
| Q |
438 |
aagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
3869806 |
aagccaaactatcccaccaatattggcaccggggagaat |
3869768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 435 - 477
Target Start/End: Original strand, 24333987 - 24334029
Alignment:
| Q |
435 |
aagaagccaaactagcccaccaaaattggcaccggggagaatt |
477 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
24333987 |
aagaagctaaactagcccacccaaattggcaccggtgagaatt |
24334029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 444 - 473
Target Start/End: Original strand, 24762379 - 24762408
Alignment:
| Q |
444 |
aactagcccaccaaaattggcaccggggag |
473 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24762379 |
aactagcccaccaaaattggcaccggggag |
24762408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 438 - 476
Target Start/End: Original strand, 902234 - 902272
Alignment:
| Q |
438 |
aagccaaactagcccaccaaaattggcaccggggagaat |
476 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
902234 |
aagccaaactagcccaccaaaattggcattggggagaat |
902272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 434 - 471
Target Start/End: Complemental strand, 28131256 - 28131219
Alignment:
| Q |
434 |
gaagaagccaaactagcccaccaaaattggcaccgggg |
471 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
28131256 |
gaagaagctaaactagcccaccaaaattggcatcgggg |
28131219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University