View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_101 (Length: 233)
Name: NF14307_high_101
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_101 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 133 - 223
Target Start/End: Original strand, 9015157 - 9015245
Alignment:
| Q |
133 |
gacccatcaaaataagtttccccattgaggcccctgcttctagtaatggcaaaagcacatattcatctttcatacattcccctgtcctttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9015157 |
gacccatcaaaataagtttccccattgaggcccctgcttctagtaatggcaaaagcac--attcatctttcatacattcccctgtcctttg |
9015245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 9015025 - 9015095
Alignment:
| Q |
1 |
actagtatatgctttttggtcacgcttttaatcctttcctttcttcacttgccacatgaagataattttgt |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
9015025 |
actagtatatgctttttggtcacgcttttaatcctttcctctcttcactttccacatgaagataattttgt |
9015095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University