View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_106 (Length: 230)
Name: NF14307_high_106
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_106 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 18403708 - 18403506
Alignment:
| Q |
16 |
acaacaacaccactagcactagcacagaattggggcacacgttcttttatgaaagaacannnnnnnatgccaggattgtcccctgaagatgcagttttaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18403708 |
acaacaacaccactagcactagcacagaattggggcacacgttcttttatgaaagaacatttttttatgccaggattgtcccctgaagatgcagttttaa |
18403609 |
T |
 |
| Q |
116 |
ggataaaacaaacagctgaagggttacataatcttagggaaatgttggaaactttgtcttggaggtatgttatgttttatataagattgaaacagaatta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18403608 |
ggataaaacaaacagctgaagggttacataatcttagggaaatgttggaaactttgtcttggaggtatgttatgttttatataagattgaaacagaatta |
18403509 |
T |
 |
| Q |
216 |
tct |
218 |
Q |
| |
|
||| |
|
|
| T |
18403508 |
tct |
18403506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University