View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14307_high_106 (Length: 230)

Name: NF14307_high_106
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14307_high_106
NF14307_high_106
[»] chr5 (1 HSPs)
chr5 (16-218)||(18403506-18403708)


Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 18403708 - 18403506
Alignment:
16 acaacaacaccactagcactagcacagaattggggcacacgttcttttatgaaagaacannnnnnnatgccaggattgtcccctgaagatgcagttttaa 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||    
18403708 acaacaacaccactagcactagcacagaattggggcacacgttcttttatgaaagaacatttttttatgccaggattgtcccctgaagatgcagttttaa 18403609  T
116 ggataaaacaaacagctgaagggttacataatcttagggaaatgttggaaactttgtcttggaggtatgttatgttttatataagattgaaacagaatta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18403608 ggataaaacaaacagctgaagggttacataatcttagggaaatgttggaaactttgtcttggaggtatgttatgttttatataagattgaaacagaatta 18403509  T
216 tct 218  Q
    |||    
18403508 tct 18403506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University