View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_112 (Length: 218)
Name: NF14307_high_112
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_112 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 47 - 109
Target Start/End: Original strand, 41627678 - 41627740
Alignment:
| Q |
47 |
aaccaagtcttaattatccaactaagtggagtagactacatggatcaaatatgccataattta |
109 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41627678 |
aaccaagtcttaattatccaactaaatggagtaggctacatggatcaaatatgccataattta |
41627740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 41627497 - 41627459
Alignment:
| Q |
167 |
tgttaaattactttgaccgtgtttcatcattatttttat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41627497 |
tgttaaattactttgaccgtgtttcatcattatttttat |
41627459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University