View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_117 (Length: 208)
Name: NF14307_high_117
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_117 |
 |  |
|
| [»] scaffold0572 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 52 - 193
Target Start/End: Complemental strand, 31992314 - 31992173
Alignment:
| Q |
52 |
gaactaatataagataaaagaataaatcatgatatgaaaatcgatcagattttagttgttcaatttgcttatcagaataaagtgcagatcagaatgacac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31992314 |
gaactaatataagataaaagaataaatcatgatatgaaaatcgatcagattttagttgttcaatttgcttatcagaataaagtgcagatcagaatgacac |
31992215 |
T |
 |
| Q |
152 |
ttgcattaaaatatgacaattatcttaaaactaattaatatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31992214 |
ttgcattaaaatatgacaattatcttaaaactaattaatatt |
31992173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 54 - 121
Target Start/End: Complemental strand, 20971532 - 20971465
Alignment:
| Q |
54 |
actaatataagataaaagaataaatcatgatatgaaaatcgatcagattttagttgttcaatttgctt |
121 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
20971532 |
actaatatttgataaaataataaatcatgatatgataattgatcagattttagttgttcaatttgctt |
20971465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 67 - 121
Target Start/End: Complemental strand, 20974098 - 20974044
Alignment:
| Q |
67 |
aaaagaataaatcatgatatgaaaatcgatcagattttagttgttcaatttgctt |
121 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
20974098 |
aaaagaataaatcaagatatgaaaatcgatcagaatttagttgctcaatttgctt |
20974044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 31992745 - 31992702
Alignment:
| Q |
18 |
caaattacgagcaccgctcaataccgcgacaaaagaactaatat |
61 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31992745 |
caaattacgagcaccactcaataccgcgacaaaagaactaatat |
31992702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 54 - 121
Target Start/End: Complemental strand, 41405130 - 41405063
Alignment:
| Q |
54 |
actaatataagataaaagaataaatcatgatatgaaaatcgatcagattttagttgttcaatttgctt |
121 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
41405130 |
actaatatttgataaaataataaatcatgatatgaaaattgataagattttagttgttcaatttgctt |
41405063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0572 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0572
Description:
Target: scaffold0572; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 54 - 121
Target Start/End: Complemental strand, 7382 - 7315
Alignment:
| Q |
54 |
actaatataagataaaagaataaatcatgatatgaaaatcgatcagattttagttgttcaatttgctt |
121 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
7382 |
actaatatttgataaaataatagatcatgatatgaaaattgataagattttagttgttcaatttgctt |
7315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University