View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_24 (Length: 485)
Name: NF14307_high_24
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 387; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 19 - 481
Target Start/End: Original strand, 26856076 - 26856538
Alignment:
| Q |
19 |
atcgaccgcattaatcggcgatgcatgtggaattggcggtgttttagcatttgaagcaggaaaacaaggagaaataaaatcagataattctctgtggttc |
118 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
26856076 |
atcgaccgcgttaatcggcgatgcatttggaattggtggtgttttagcatttgaagcgggaagacaaggagaaataaaatcagagaattctttgtggttc |
26856175 |
T |
 |
| Q |
119 |
atgatttctgttgtagttgtggcaatacttttattttgctgtattaggccaacaatgatgtggattaatagaaaaacaccagaaggagaagaagtggatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26856176 |
atgatttctgttgtagttgtggcaatacttttactttgttgtattaggccaacaatgatgtggattaatagaaaaacaccagaaggacaagaagtggatc |
26856275 |
T |
 |
| Q |
219 |
aatcttttgttgttgctattattttaggggtttttgtgatggcatttataactgacatgtttggtatagcaattgttaatggatctttctggttagggtt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || || |
|
|
| T |
26856276 |
aatcttttgttgttgctattattttaggggtttttgtgatggcatttataactgacatgtttggtatagcaattgttaatgggtctttctggttgggttt |
26856375 |
T |
 |
| Q |
319 |
ggttactcctgatggacctcgtttaggagcaacaatggtacaaaagaccaagactattatgaatgagtttcttatgccattttcattcattatggtggga |
418 |
Q |
| |
|
|||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26856376 |
ggttacaccggatggacctcgtttaggaacaacaatggtacaaaagaccaagactattatgaatgagtttcttatgccattttcattcattatggtggga |
26856475 |
T |
 |
| Q |
419 |
caatattttgatttgtttgcattgggggcttctgattggaaaactttgcaacctttgcttctc |
481 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
26856476 |
caatattttgatttttttgcattgggggcttctgattggaaaagtttgcaacctttgtttctc |
26856538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University