View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_35 (Length: 438)
Name: NF14307_high_35
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 19 - 431
Target Start/End: Complemental strand, 29116737 - 29116323
Alignment:
| Q |
19 |
gattttggcttctccacgaatctactcacaatgcttacactatatgtcaaatatggctttgtgttgcaaaggtatcttcgatgatccaataagtcttttg |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29116737 |
gattttggcttctccaggaatctactcacaatgcctacactatatgtcaaatatggctttgtgttgcaaaggtatcttcgatgatccaatgagtcttttg |
29116638 |
T |
 |
| Q |
119 |
tattgagttggatccacttctctctcttttatttcatttcatagttttggtcttggttcaatgggggttacatcaagatttcaatactccatctaaaacc |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
29116637 |
tattgagttggatccacttctttctcttttatttcttttgatagttttggtcttggttcaataggggttacatcaagattgcaatattccatctaaaacc |
29116538 |
T |
 |
| Q |
219 |
ttttaagaatttcactagc--atatctcttttgatgaattagaagccctacttgttctttgaaactccatggcaaggaaatatgagatgtgaagtagatc |
316 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
29116537 |
ttttaagaatttcactagcatatatctcttttgatgaattagaagccctacttgttctttgaaactccatgcgaaggaaatatgaaatgtgacctagatc |
29116438 |
T |
 |
| Q |
317 |
aaccatctcaaattccttcatcaaatcattcttaaagtcgtttatgtaagatccattgctacatgtgataagaaaatcatttacataaagatatagaatg |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29116437 |
aaccatctcaaattccttcatcaaatcattcttaaattcgtttatgtaagatccattgctacatgtgataagaaaatcatttacataaagatatagaatg |
29116338 |
T |
 |
| Q |
417 |
attacccctttgctt |
431 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29116337 |
attacccctttgctt |
29116323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University