View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_36 (Length: 436)
Name: NF14307_high_36
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 375; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 23 - 421
Target Start/End: Original strand, 39299933 - 39300331
Alignment:
| Q |
23 |
atatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtccaactacatttgtagcatgatgacgatccctctcactctgtttca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299933 |
atatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtccaactacatttgtagcatgatgacgatccctctcactctgtttca |
39300032 |
T |
|
| Q |
123 |
cattttgatcagagtgagactgaaaaccttgtttgtgtccaaggttggtagcagcagcatgatgatgatccctatcactctgcttcacatttgaaccaag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300033 |
cattttgatcagagtgagactgaaaaccttgcttgtgaccaaggttcgtagcagcagcatgatgatgatccctatcactctgcttcacatttgaaccaag |
39300132 |
T |
|
| Q |
223 |
ttcatgagtctctcttgatcttcctcttccaccaatatctccaatggcttttcctgcatgatctttgttcatttcaccaccttgtaatgcttcaatgcta |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300133 |
ttcatgagtctctcttgatcttcctcttccaccaatatctccaatggcttttcctgcatgatctttgttcatttcaccaccttgtaatgcttcaatgcta |
39300232 |
T |
|
| Q |
323 |
ccatgtggtggttccttgtctaccactgtaagttgttcaaaatgagttgtcatctttgggactctgtctttttcaacatgaatatctctctcgtctgtg |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39300233 |
ccatgtggtggttccttgtctaccactgtaagttgttcaaaatgggtagtcatctttgggactctgtctttttcaacatgaatatctctctcgtttgtg |
39300331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 212 - 264
Target Start/End: Original strand, 39299888 - 39299940
Alignment:
| Q |
212 |
tttgaaccaagttcatgagtctctcttgatcttcctcttccaccaatatctcc |
264 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
39299888 |
tttgaaccaagttcatggctctctctttctcttcctcttccaccaatatctcc |
39299940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University