View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_67 (Length: 319)
Name: NF14307_high_67
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 53 - 304
Target Start/End: Original strand, 40805473 - 40805724
Alignment:
| Q |
53 |
tgcttaatcagttgaattcaaattccattagataaaacttgtgatggtgtttttcccttaactgcattattaataaagagaaagatgaagggaagagaaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40805473 |
tgcttaatcagttgaattcaaattccattagataaaacttgtgatggtgtttttcccttaactgcattattaataaagagaaagatgaagggaagagaaa |
40805572 |
T |
 |
| Q |
153 |
aagagttgaaatgcttgctgctagtgcttgcttgtgactactgaatagttgcaatcagtagtagtagttgcggaccacaacatcctctaaagaacctttc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40805573 |
aagagttgaaatgcttgctgctagtgcttgcttgtgactactgaatagttgcaatcagtagtagtagttgcggaccacaacatcctctaaagaacctttc |
40805672 |
T |
 |
| Q |
253 |
tgccacttcatactttatttatttattccattactacccttcattccttcag |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40805673 |
tgccacttcatactttatttatttattccattactacccttcattccttcag |
40805724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University