View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_70 (Length: 313)
Name: NF14307_high_70
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 9 - 295
Target Start/End: Complemental strand, 14817837 - 14817552
Alignment:
| Q |
9 |
aaaataaacttttaaaatgataacatcgtgagactcatgttctctatatttgctcaatatcatttcaaaggatcgattggagtagacactcccttggtca |
108 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14817837 |
aaaataaacttt-aaaatgacaacatcgtgagactcatgttctctatatttgctcaatatcatttcaaaggatcgattggagtagacactcccttggtca |
14817739 |
T |
 |
| Q |
109 |
tatttgtttatgctattgatgcaaaatatcacacacgagcaatatcgaagggtttgtgtgaactgagcggaggagaaaatcacaaccaatgaaccaaacc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
14817738 |
tatttgtttatgctattgatgcaaaatatcacacacgagcaatttcgaagggtttgggtgaactgagcggaggagaaaatgataaccaatgaaccaaacc |
14817639 |
T |
 |
| Q |
209 |
caaataatccccaaaggtcgctggaccaataatagacaacattataaaggggatgctagatttgggggaccctataatgtatgaagt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14817638 |
caaataatccccaaaggtcgctggaccaataatagacaacattataaagtggatgctagatttgggggaccctataatgtatgaagt |
14817552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University