View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_74 (Length: 293)
Name: NF14307_high_74
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_74 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 42845795 - 42846068
Alignment:
| Q |
1 |
acaagcagctaaggcagggaagagagaaaagacagaaatgacaatggattttttgtactgggaggctatgagccgtgcaaacgtcaatgaaattgctgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42845795 |
acaagcagctaaggcagggaagagagaaaagacagaaatgacaatggattttttgtactgggaggctatgagccgtgcaaacgtcaatgaaattgctgag |
42845894 |
T |
 |
| Q |
101 |
cactcaaagaaagaggcatggataacatgcttgcagaacttattcagagtttcctacctgaatctactcgttgatgcacacagggctactgatcttgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42845895 |
cactcaaagaaagaggcatggataacatgcttgcagaacttattcagagtttcctacctgaatctactcgttgatgcacacagggctactgatcttgtgt |
42845994 |
T |
 |
| Q |
201 |
ggctgagagatgtttcacctgactaagcaaaataattcatgctcagcataaggggatcgggaatgaaaagtgtg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42845995 |
ggctgagagatgtttcacctgactaagcaaaataattcatgctcaacataaggggatcgggaatgaaaagtgtg |
42846068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 7 - 139
Target Start/End: Original strand, 41979923 - 41980056
Alignment:
| Q |
7 |
agctaaggcagggaagagagaaaagacagaaatgacaatggattttttgtactgggaggctatgagccgtgcaaacgtcaatgaaattgctga-gcactc |
105 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| | ||||| | ||| ||||||| ||| |||| || ||||||||||| ||||||||||| ||| || |
|
|
| T |
41979923 |
agctacggctgggaagagagaaaagacagaaagcaacatggactcattggactgggaagctgtgagacgggcaaacgtcaaggaaattgctgatgcaatc |
41980022 |
T |
 |
| Q |
106 |
aaagaaagaggcatggataacatgcttgcagaac |
139 |
Q |
| |
|
||||| || |||||| | ||||||||||| |||| |
|
|
| T |
41980023 |
aaagagaggggcatgaacaacatgcttgctgaac |
41980056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 157 - 231
Target Start/End: Original strand, 41980173 - 41980247
Alignment:
| Q |
157 |
cctgaatctactcgttgatgcacacagggctactgatcttgtgtggctgagagatgtttcacctgactaagcaaa |
231 |
Q |
| |
|
|||||||||||||||||| |||| |||||| |||||| | |||||| ||||||||| |||||||| ||||||| |
|
|
| T |
41980173 |
cctgaatctactcgttgaaaaacacggggctattgatctcgagtggcttagagatgttccacctgaccaagcaaa |
41980247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 41980450 - 41980490
Alignment:
| Q |
234 |
aattcatgctcagcataaggggatcgggaatgaaaagtgtg |
274 |
Q |
| |
|
||||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
41980450 |
aattcttgctcagcataaggggattgggattgaaaagtgtg |
41980490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University