View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_81 (Length: 275)
Name: NF14307_high_81
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 94 - 259
Target Start/End: Complemental strand, 41343407 - 41343247
Alignment:
| Q |
94 |
agctgggattacaccttttgtggtggcagggattgaatttagcaagagaattgtaagtcacnnnnnnnacttgattattgctatctcatctcataaatta |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
41343407 |
agctgggattacaccttttgtggtggcagggattgaatttagcaagagaattgtaagtcactttttttacttgattattgctatctcat-----aaatta |
41343313 |
T |
 |
| Q |
194 |
tgaatctcattcttgtgtgttttttgtcttcaattttgaatatttgttacagattgctcaaaaaag |
259 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343312 |
tgaatctcattcttgtatgttttttgtcttcaattttgaatatttgttacagattgctcaaaaaag |
41343247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University