View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14307_high_86 (Length: 252)

Name: NF14307_high_86
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14307_high_86
NF14307_high_86
[»] chr3 (1 HSPs)
chr3 (16-230)||(30784049-30784263)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 30784263 - 30784049
Alignment:
16 attattctatgctattattggaatttttggggggaatatggttttttaaaagtgtgtttttatctcatattagctttcaaataattgaaggttattgata 115  Q
    ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
30784263 attattctatgctattattggaatttttggggggagtatggtttttaaaaagtgtgtttttatctcatattagctttcaaataattgaaggttattgata 30784164  T
116 tgactggtgattaattaactaattgatagttatgttaattagttataggcagattatggacatagaactgattttggatttcaactgacttatataaaaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
30784163 tgactggtgattaattaactaattgatagttatgttaattagttataggcagattattgacatagaactgattttggatttcaactgacttatataaaaa 30784064  T
216 tactataggagcgta 230  Q
    |||||||||||||||    
30784063 tactataggagcgta 30784049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University