View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_91 (Length: 248)
Name: NF14307_high_91
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_91 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 16 - 180
Target Start/End: Original strand, 11218946 - 11219113
Alignment:
| Q |
16 |
atatgttttgaaaggcttga---cccaacggtagtgcaaaccggaaataattccattaatagtttccacaataaaaatgctttgctcatgcagaatcaga |
112 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11218946 |
atatgttttgaaagccttgaaaacccaacggtagtgcaaaccggacataattccattaatagtttccacaataaaaatgctttgctcatgcagaatcaga |
11219045 |
T |
|
| Q |
113 |
ttgaccagcactaatggtcaatcttccatagtgtatgatagacgagtggctaatctgctggcacacta |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11219046 |
ttgaccagcactaatggtcaatcttccatagtgtatgatagacgagtggctaatctgctggcacacta |
11219113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 178 - 230
Target Start/End: Original strand, 11219274 - 11219326
Alignment:
| Q |
178 |
ctatctagcaaaattttctctttcaaatctggattgtgtttggattgaagatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11219274 |
ctatctagcaaaattttctctttcaaatctggattgtgtttggattgaagatg |
11219326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 172 - 229
Target Start/End: Complemental strand, 41866393 - 41866336
Alignment:
| Q |
172 |
ggcacactatctagcaaaattttctctttcaaatctggattgtgtttggattgaagat |
229 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
41866393 |
ggcacattatctagcaaaatttgctctttcaaatccggattatgtttggattgaagat |
41866336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 223
Target Start/End: Complemental strand, 20203999 - 20203951
Alignment:
| Q |
175 |
acactatctagcaaaattttctctttcaaatctggattgtgtttggatt |
223 |
Q |
| |
|
||||||||| ||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
20203999 |
acactatcttgcaaaatttgctatttcaaatccagattgtgtttggatt |
20203951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 223
Target Start/End: Complemental strand, 22098022 - 22097974
Alignment:
| Q |
175 |
acactatctagcaaaattttctctttcaaatctggattgtgtttggatt |
223 |
Q |
| |
|
||||||||| ||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
22098022 |
acactatcttgcaaaatttgctatttcaaatccagattgtgtttggatt |
22097974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University