View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_92 (Length: 248)
Name: NF14307_high_92
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_92 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 234
Target Start/End: Complemental strand, 40491592 - 40491363
Alignment:
| Q |
5 |
ccaggctgtttggcttagttggtgccatttggatatgcaaacttacgaactacaactaaagatttaagcctatatagaattcactacttttaagaatatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40491592 |
ccaggctgtttggcttagttggtgccattttgatatgcaaacttacgaactacaactaaagatttaatcctatatagaattcactacttttaagaatatt |
40491493 |
T |
|
| Q |
105 |
tttatatagagtttcttaacatatgcttagaatattatttatttttcaaagtaaaatttctacttttagactctttaccatgtctttagaccatgagtta |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40491492 |
tttatttagagtttcttaacatatgcttagaatattatttatttttcaaagtaaaatttctacttttagactctttaccatgtctttagaccatgagtta |
40491393 |
T |
|
| Q |
205 |
gaagaacccatcaataaggcaaatgctcat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40491392 |
gaagaacccatcaataaggcaaatgctcat |
40491363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 105 - 180
Target Start/End: Original strand, 27913361 - 27913434
Alignment:
| Q |
105 |
tttatatagagtttcttaacatatgcttagaatattatttatttttcaaagtaaaatttctacttttagactcttt |
180 |
Q |
| |
|
||||||| |||||||||||||| || ||||||||| ||| |||||||||||||||||| ||||||| || ||||| |
|
|
| T |
27913361 |
tttatatcgagtttcttaacatgtgtttagaatataatt--tttttcaaagtaaaatttttacttttggattcttt |
27913434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University