View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_high_95 (Length: 242)
Name: NF14307_high_95
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_high_95 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 21 - 219
Target Start/End: Complemental strand, 30769853 - 30769655
Alignment:
| Q |
21 |
ctcgaaaggcgtgaacataggtctctcagagaagaactgcgatccacgaccacgattctggtgtcaccgcctacataacataaagacttatcgtgagggc |
120 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
30769853 |
ctcgaaagacgcgaacataggtctctcagagaagaactgcgatccacgaccacgattctggtgtcaccacctacataacatagagacttatcatgagggc |
30769754 |
T |
 |
| Q |
121 |
gcggcattatgtggcctccgtagctgcacatgagccgaagcttgcctccggggacattagggaaggaatcgtcgttcattgtttcattaacgcgtgatc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769753 |
gcggcattatgtggcctccgtagctgcacattagccgaagcttgcctccggggacattagggaaggaatcgtcgttcattgtttcattaacgcgtgatc |
30769655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University