View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_102 (Length: 241)
Name: NF14307_low_102
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_102 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 83 - 161
Target Start/End: Complemental strand, 29206180 - 29206102
Alignment:
| Q |
83 |
agatttcttaaattcaaaaacatagaaaacaaacctctggaaagcttcaataagtttcagctttaagagtaagcttcaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
29206180 |
agatttcttaaattcaaaaacatagaaaacaaacctctggaaagcttcaataagtttcaggtttaagagtaaacttcaa |
29206102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 224
Target Start/End: Original strand, 1682349 - 1682398
Alignment:
| Q |
175 |
gtttaccaaaggaggatggagggttaggtaggaggaagttgcgtgaattt |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
1682349 |
gtttacctaaggaggatggagggttaggtgtgcggaagttacgtgaattt |
1682398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University