View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_103 (Length: 239)
Name: NF14307_low_103
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_103 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 2097944 - 2098129
Alignment:
| Q |
17 |
aaaactgttgtatcttttcaatcatgatttcgtacttttatactagtacttctgtgtcgtcctccaattaaaaaacaaatactccattattagggtatct |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2097944 |
aaaactgttgtatcttttcattcatgatttcgtacttttatactagtacttctgtgtcgtcctccaattataaaacaaatactccattattagggtatct |
2098043 |
T |
 |
| Q |
117 |
ccaacccgtggtattacattaccaggaaagtcaccaacacgggaacaccaaacacgctgattataacctaccgccaactttctaat |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2098044 |
ccaacccgtggtattacattacgaggaaagtcaccaacacgggaacaccaaacacgctgattataacctatcgccaactttataat |
2098129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University