View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_111 (Length: 230)
Name: NF14307_low_111
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_111 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 7 - 230
Target Start/End: Original strand, 35475433 - 35475654
Alignment:
| Q |
7 |
taaatgagcatccttgtctctcggatttgtaagagtcgaacactttatatattaaatttgtaaaatagaaaattatttgtaaatttcaaaaatgtaaatt |
106 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35475433 |
taaatgagcatgcttgtctctcggaattgtaagaatcgaacactttaaat--taaatttgtaaaatagaaaattatttgcaaatttcaaaaatgtaaatt |
35475530 |
T |
 |
| Q |
107 |
gatcaacccatataaacactatatactagtggtacattgtatttgtctagaaatgaataataataatgacaaatccctctatttacgcggagttacgtaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
35475531 |
gatcaacccatataaacactatatactagtggtgcattgtatttgtctagaaatgaataataataatgagaaatccctctatttacgcggagttacctaa |
35475630 |
T |
 |
| Q |
207 |
cattgattcctaatgcatcaaaaa |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35475631 |
cattgattcctaatgcatcaaaaa |
35475654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University