View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_114 (Length: 227)
Name: NF14307_low_114
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_114 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 30196614 - 30196382
Alignment:
| Q |
7 |
gtcttctctaatatatattgtacattctcgttgaatagaagttgtattagaatagtttgaaaaagtttagttcatacgatgtccatcttcagttctagta |
106 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30196614 |
gtcttctctgatatatattgcacattctcgttgaatagaagttgtattagaatagtttgaaaaagtttagttcatacgatgtcaatcttcagttctagta |
30196515 |
T |
|
| Q |
107 |
acaaaaatagtgttaatttctgttgtgagtgtttgatttctgcaacttgctgcccaaattatctgacaaatatatgaggaagagga------------ag |
194 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
30196514 |
acaaaaatagtgttaatttctgttgcgagtgtttgatttctgcaacttgctgcccaaattatctcacaaatatatgaggaagaggaagaggaagaggaag |
30196415 |
T |
|
| Q |
195 |
agtatccttcgctaattttactagtcaaaggca |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30196414 |
agtatccttcgctaattttactagtcaaaggca |
30196382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University