View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_118 (Length: 220)
Name: NF14307_low_118
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_118 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 7806571 - 7806379
Alignment:
| Q |
12 |
gaagaaaatgattgtattaaaataagataagataacctggattccaattgca-ttaacaaaatgacaaattttccaactagttggatatcagcctcagtc |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7806571 |
gaagaaaatgattgtattaagataagataagataacttggattccaattgcaattaacaaaatgacaaattttccaactagttggatatcagcctcagtc |
7806472 |
T |
 |
| Q |
111 |
aaataagggcaaaataccggttcaaactcaggtaaaagtttttaatctaacaaaatcaatatttatcaattgaactaagtattacatacaact |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7806471 |
gaataagggcaaaataccggttcaaactcaggtaaaagtttttaatctaacaaaatcaatatttatcaattgaactaagtattacatacaact |
7806379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University