View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_13 (Length: 547)
Name: NF14307_low_13
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 41782074 - 41782118
Alignment:
| Q |
18 |
aaactgttgatatggccatttggtatataaatgtattagggtgtc |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41782074 |
aaactgttgatatggccatttggtatataaatgtattagggtgtc |
41782118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 22 - 63
Target Start/End: Complemental strand, 18163602 - 18163561
Alignment:
| Q |
22 |
tgttgatatggccatttggtatataaatgtattagggtgtca |
63 |
Q |
| |
|
||||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
18163602 |
tgttgatgtggccatctggtatataaatttattagggtgtca |
18163561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University