View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14307_low_13 (Length: 547)

Name: NF14307_low_13
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14307_low_13
NF14307_low_13
[»] chr5 (1 HSPs)
chr5 (18-62)||(41782074-41782118)
[»] chr2 (1 HSPs)
chr2 (22-63)||(18163561-18163602)


Alignment Details
Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 41782074 - 41782118
Alignment:
18 aaactgttgatatggccatttggtatataaatgtattagggtgtc 62  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
41782074 aaactgttgatatggccatttggtatataaatgtattagggtgtc 41782118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 22 - 63
Target Start/End: Complemental strand, 18163602 - 18163561
Alignment:
22 tgttgatatggccatttggtatataaatgtattagggtgtca 63  Q
    ||||||| ||||||| |||||||||||| |||||||||||||    
18163602 tgttgatgtggccatctggtatataaatttattagggtgtca 18163561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University