View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14307_low_2 (Length: 860)

Name: NF14307_low_2
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14307_low_2
NF14307_low_2
[»] chr3 (5 HSPs)
chr3 (17-847)||(49700736-49701568)
chr3 (434-476)||(44745943-44745985)
chr3 (435-476)||(30852117-30852158)
chr3 (434-472)||(12761589-12761627)
chr3 (434-476)||(43303830-43303872)
[»] chr1 (6 HSPs)
chr1 (434-476)||(6127948-6127990)
chr1 (776-843)||(2242434-2242501)
chr1 (438-476)||(34228946-34228984)
chr1 (434-476)||(36428785-36428827)
chr1 (438-477)||(44486123-44486162)
chr1 (434-476)||(31605809-31605851)
[»] chr4 (6 HSPs)
chr4 (435-476)||(25414177-25414218)
chr4 (435-476)||(55256161-55256202)
chr4 (434-476)||(33867375-33867417)
chr4 (435-476)||(46295170-46295211)
chr4 (434-476)||(2732067-2732109)
chr4 (434-476)||(26356890-26356932)
[»] chr8 (4 HSPs)
chr8 (435-475)||(3078607-3078647)
chr8 (434-477)||(27557605-27557648)
chr8 (434-476)||(11793482-11793524)
chr8 (439-472)||(35475542-35475575)
[»] chr7 (3 HSPs)
chr7 (434-477)||(48125136-48125179)
chr7 (437-476)||(38374563-38374602)
chr7 (434-476)||(45559264-45559306)
[»] chr2 (5 HSPs)
chr2 (434-476)||(21213842-21213884)
chr2 (437-476)||(27967113-27967152)
chr2 (434-476)||(6099480-6099522)
chr2 (434-472)||(41908599-41908637)
chr2 (435-476)||(32106639-32106680)
[»] chr6 (4 HSPs)
chr6 (434-475)||(23242060-23242101)
chr6 (438-476)||(3869768-3869806)
chr6 (435-477)||(24333987-24334029)
chr6 (444-473)||(24762379-24762408)
[»] chr5 (2 HSPs)
chr5 (438-476)||(902234-902272)
chr5 (434-471)||(28131219-28131256)


Alignment Details
Target: chr3 (Bit Score: 712; Significance: 0; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 712; E-Value: 0
Query Start/End: Original strand, 17 - 847
Target Start/End: Complemental strand, 49701568 - 49700736
Alignment:
17 atgaagaacaagttcattccgtcccaaaacaaaattcttctgtgtttaagttattagacttacatgttctactccattcacccgtttgataagttcctgt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49701568 atgaagaacaagttcattccgtcccaaaacaaaattcttctgtgtttaagttattagacttacatgttctactccattcacccgtttgataagttcctgt 49701469  T
117 tactcaaaagaaaaaggaaggttcagtttgcattttccccctatattatagaaaaagacatttgagaaatacaaattgtgtatacgttcaaaggaaaatt 216  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49701468 aactcaaaagaaaaaggaaggttcagtttgcattttccccctatattatagaaaaagacatttgagaaatacaaattgtgtatacgttcaaaggaaaatt 49701369  T
217 aaacacagccacaataaaatgcagatttttaaattacttaacttcacttgcaacatgactcctttcttatgttgttatcctcaatgttcaaatatcacgt 316  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
49701368 aatcacagccacaataaaatgcagatttttaaattacttaacttcacttgaaacatgactcctttcttatgttgttatcctcaatgttcaaatatcacgt 49701269  T
317 cgaattatgactaactcaagtcaatggatgggataaaactctcctgacaattannnnnnnncattcttgaaactcaaattaatttgccacattacttaac 416  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||    
49701268 cgaattatgactaactcaagtcaatggatgggataaaactctcctgacaattattttttttcattcttgaaactcaaattaatttgccacattacttaac 49701169  T
417 aaaagnnnnnnnnnnnn-gaagaagccaaactagcccaccaaaattggcaccggggagaattcat-acttaagaaaatttaaacagtagaacttctgaaa 514  Q
    |||||             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
49701168 aaaagtttttttttttttgaagaagccaaactagcccaccaaaattggcaccggggagaattcattacttaagaaaatttaaacagtagaacttctgaaa 49701069  T
515 aattgaaatgcataagctaatttcaaaatattattttaaaaactaatagtcagtttggagtttgatgttggtgaagtctacatcagtgtgatagaaactg 614  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
49701068 aattgaaatgcataagctaatttcaaaatattattttaaaaactaatagtcagtgtggagtttgatgttggtgaagtctacatcagtgtgatagaaactg 49700969  T
615 cttaactagtataactaaattgaaagcannnnnnncttcataaaagcagtaatgaatgatgtataaaacagctttaattggaaacatatcttatcaaaaa 714  Q
    ||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49700968 cttaactagtataactaaattgaaagcatttttttcttcataaaagcagtaatgaatgatgtataaaacagctttaattggaaacatatcttatcaaaaa 49700869  T
715 ataaaatgaagtaagagattaatggggtatagtttcttaccgcggcaccggtgacaaaaacataaaagtctgttggtgcttcattatccaaaatcacatc 814  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
49700868 ataaaatgaagtaagagattaatggggtatagtttcctaccgcggcaccggtgacaaaaatataaaagtctgttggtgcttcattatccaaaatcacatc 49700769  T
815 ttcctttggaggaaaatactccgccttcatctc 847  Q
    |||||||||||||||||||||||||||||||||    
49700768 ttcctttggaggaaaatactccgccttcatctc 49700736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 44745943 - 44745985
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||||||||||||| |||||||||||||| |||||||||    
44745943 gaagaagccaaactagcctaccaaaattggcactggggagaat 44745985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 435 - 476
Target Start/End: Original strand, 30852117 - 30852158
Alignment:
435 aagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    ||||||| ||||||||||||||||||||| ||||||||||||    
30852117 aagaagctaaactagcccaccaaaattggtaccggggagaat 30852158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 472
Target Start/End: Complemental strand, 12761627 - 12761589
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccgggga 472  Q
    |||||||| ||||||||||||| ||||||||||||||||    
12761627 gaagaagcaaaactagcccacctaaattggcaccgggga 12761589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 43303872 - 43303830
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||||||||||||||||| | ||| ||||||||||||||    
43303872 gaagaagccaaactagcccaccgatattagcaccggggagaat 43303830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 6127948 - 6127990
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||||||||||||||||||||||||||||||||||||||    
6127948 gaagaagccaaactagcccaccaaaattggcaccggggagaat 6127990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 776 - 843
Target Start/End: Original strand, 2242434 - 2242501
Alignment:
776 ataaaagtctgttggtgcttcattatccaaaatcacatcttcctttggaggaaaatactccgccttca 843  Q
    ||||||||||||||||| |||||| | ||| |  ||||||||||||||||||||| |||| |||||||    
2242434 ataaaagtctgttggtgattcattctgcaagactacatcttcctttggaggaaaaaactcagccttca 2242501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 438 - 476
Target Start/End: Complemental strand, 34228984 - 34228946
Alignment:
438 aagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||||||||||||||||||||||||||| ||||||    
34228984 aagccaaactagcccaccaaaattggcaccggagagaat 34228946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 36428827 - 36428785
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||| ||||||||||||| ||||||||||||||||||||    
36428827 gaagaagcaaaactagcccacccaaattggcaccggggagaat 36428785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 438 - 477
Target Start/End: Original strand, 44486123 - 44486162
Alignment:
438 aagccaaactagcccaccaaaattggcaccggggagaatt 477  Q
    ||||||||||| |||||| |||||||||||||||||||||    
44486123 aagccaaactaacccaccgaaattggcaccggggagaatt 44486162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 31605809 - 31605851
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    ||||| || ||||||||||||| ||||||||||||||||||||    
31605809 gaagaggctaaactagcccacccaaattggcaccggggagaat 31605851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000005; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 435 - 476
Target Start/End: Original strand, 25414177 - 25414218
Alignment:
435 aagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||||||||| |||||||||||||||||||||||||||    
25414177 aagaagccaaactaacccaccaaaattggcaccggggagaat 25414218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 435 - 476
Target Start/End: Original strand, 55256161 - 55256202
Alignment:
435 aagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||||||||||||||||||||||||||||| |||||||    
55256161 aagaagccaaactagcccaccaaaattggcaccgaggagaat 55256202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 33867417 - 33867375
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||| ||||||||||||||| ||||||||||||||||||||    
33867417 gaagaaaccaaactagcccaccgaaattggcaccggggagaat 33867375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 435 - 476
Target Start/End: Complemental strand, 46295211 - 46295170
Alignment:
435 aagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    ||||||| ||||||||||||| ||||||||||||||||||||    
46295211 aagaagctaaactagcccacccaaattggcaccggggagaat 46295170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 2732109 - 2732067
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||| ||||||||||||| ||||||||||||| ||||||    
2732109 gaagaagctaaactagcccacccaaattggcaccggagagaat 2732067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 26356932 - 26356890
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||| ||||||||||||| |||||||||| |||||||||    
26356932 gaagaagctaaactagcccacctaaattggcactggggagaat 26356890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 435 - 475
Target Start/End: Complemental strand, 3078647 - 3078607
Alignment:
435 aagaagccaaactagcccaccaaaattggcaccggggagaa 475  Q
    ||||||| |||||||||||||||||||||||||||||||||    
3078647 aagaagctaaactagcccaccaaaattggcaccggggagaa 3078607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 434 - 477
Target Start/End: Original strand, 27557605 - 27557648
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaatt 477  Q
    ||||||||||||||| |||||| |||||||||||||||||||||    
27557605 gaagaagccaaactaccccaccgaaattggcaccggggagaatt 27557648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 11793482 - 11793524
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||| ||||||||||||| |||||||||||||| |||||    
11793482 gaagaagctaaactagcccacccaaattggcaccgggaagaat 11793524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 472
Target Start/End: Original strand, 35475542 - 35475575
Alignment:
439 agccaaactagcccaccaaaattggcaccgggga 472  Q
    ||||||||||||||||| ||||||||||||||||    
35475542 agccaaactagcccaccgaaattggcaccgggga 35475575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000008; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 434 - 477
Target Start/End: Original strand, 48125136 - 48125179
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaatt 477  Q
    |||||||||||||||||||||| |||||||||||||||| ||||    
48125136 gaagaagccaaactagcccaccgaaattggcaccggggaaaatt 48125179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 437 - 476
Target Start/End: Original strand, 38374563 - 38374602
Alignment:
437 gaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    ||||| ||||||||||||| ||||||||||||||||||||    
38374563 gaagctaaactagcccacctaaattggcaccggggagaat 38374602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 45559306 - 45559264
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    ||||||| |||| || |||||||||||||||||||||||||||    
45559306 gaagaagtcaaattaacccaccaaaattggcaccggggagaat 45559264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000003; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 476
Target Start/End: Complemental strand, 21213884 - 21213842
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||| ||||||||||||| ||||||||||||||||||||    
21213884 gaagaagcaaaactagcccacctaaattggcaccggggagaat 21213842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 437 - 476
Target Start/End: Original strand, 27967113 - 27967152
Alignment:
437 gaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||||||| ||||||||||||| |||||||||||||    
27967113 gaagccaaactaacccaccaaaattgccaccggggagaat 27967152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 476
Target Start/End: Original strand, 6099480 - 6099522
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    |||||||||||||||||||||| | ||||||| ||||||||||    
6099480 gaagaagccaaactagcccaccgatattggcagcggggagaat 6099522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 434 - 472
Target Start/End: Original strand, 41908599 - 41908637
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccgggga 472  Q
    |||||||| ||||||||||||| ||||||||||||||||    
41908599 gaagaagctaaactagcccacccaaattggcaccgggga 41908637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 435 - 476
Target Start/End: Complemental strand, 32106680 - 32106639
Alignment:
435 aagaagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    ||||||||||||||||||||  ||||||||||||| ||||||    
32106680 aagaagccaaactagcccactgaaattggcaccggagagaat 32106639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.000000001; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 434 - 475
Target Start/End: Complemental strand, 23242101 - 23242060
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccggggagaa 475  Q
    |||||||| ||||||||||||| |||||||||||||||||||    
23242101 gaagaagctaaactagcccacccaaattggcaccggggagaa 23242060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 438 - 476
Target Start/End: Complemental strand, 3869806 - 3869768
Alignment:
438 aagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    ||||||||||| |||||||| ||||||||||||||||||    
3869806 aagccaaactatcccaccaatattggcaccggggagaat 3869768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 435 - 477
Target Start/End: Original strand, 24333987 - 24334029
Alignment:
435 aagaagccaaactagcccaccaaaattggcaccggggagaatt 477  Q
    ||||||| ||||||||||||| ||||||||||||| |||||||    
24333987 aagaagctaaactagcccacccaaattggcaccggtgagaatt 24334029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 444 - 473
Target Start/End: Original strand, 24762379 - 24762408
Alignment:
444 aactagcccaccaaaattggcaccggggag 473  Q
    ||||||||||||||||||||||||||||||    
24762379 aactagcccaccaaaattggcaccggggag 24762408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000008; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 438 - 476
Target Start/End: Original strand, 902234 - 902272
Alignment:
438 aagccaaactagcccaccaaaattggcaccggggagaat 476  Q
    ||||||||||||||||||||||||||||  |||||||||    
902234 aagccaaactagcccaccaaaattggcattggggagaat 902272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 434 - 471
Target Start/End: Complemental strand, 28131256 - 28131219
Alignment:
434 gaagaagccaaactagcccaccaaaattggcaccgggg 471  Q
    |||||||| ||||||||||||||||||||||| |||||    
28131256 gaagaagctaaactagcccaccaaaattggcatcgggg 28131219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University