View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_20 (Length: 505)
Name: NF14307_low_20
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 9 - 471
Target Start/End: Complemental strand, 11212906 - 11212438
Alignment:
| Q |
9 |
tttgccataaaacgacaccgtttttagtctccagaactaaatttccattttctagaagattgagttgaggaagaggagattca---agagtgtttttagt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11212906 |
tttgccataaaacgacaccgtttttagtctcgagaactaaatttccattttctagaagattcagttgaggaagaggagattcatcaagagtgtttttagt |
11212807 |
T |
|
| Q |
106 |
ttgccataaaacggtgtcgttttgggttaagagtaattgaccggttcgagttaattgaagtgctgaaccggtgagagatgagatgggtttattccggttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11212806 |
ttgccataaaacggtgtcgttttgggttaagagtaattgaccggttggggttaattgaagagctgaaccggtgagagatgagatgggtttattacggttt |
11212707 |
T |
|
| Q |
206 |
gcgacccaaatgatgtttggagaagggagggaagtgaaacggatggaaagatagtaacgaggttgtagttggttttgttgttctaagttgaagagaccaa |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11212706 |
gcgacccaaatgatgtttggagaagggagggaagtgaaacggatggaaagatagtaacgaggttgtagttggttttgttgttctaagttgaagagaccaa |
11212607 |
T |
|
| Q |
306 |
gttggaaggtttggttttggcttaagagtgttttgttttgtgataaaatgattgtgttggaaagagtgaagtgaggtaagagaaggaagagaaaaaatag |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11212606 |
gttggaaggtttggttttggcttaagagtgttttgttttgtgataaaatgattgtgttggaaagagtgaagtgaggtaatagaaggaagagaaaaaatag |
11212507 |
T |
|
| Q |
406 |
gaacattgttttttgaggttgtc-----gaagggaaaaatgttgaatgaaattggaagaaagataagtaga |
471 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11212506 |
gaacattg--ttttgaggttgtcggagggaagggaaaaatgttgaatgaaattggaagaaagataagtaga |
11212438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University