View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_55 (Length: 373)
Name: NF14307_low_55
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 363
Target Start/End: Original strand, 40740590 - 40740946
Alignment:
| Q |
1 |
acacacgttctgtgtgtacttgcttgaccgtttgtgttccttagtttatcnnnnnnnnnnnnntgtcaacaaaagaatcaaacaacttctgcatttacga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40740590 |
acacacgttctgtgtgtacttgcttgaccgtttgtgttccttagtttatccaaaagaaaaaaatgtcaacaaaagaatcaaacaacttctgcatttacga |
40740689 |
T |
 |
| Q |
101 |
ttctcgtattgcaacattggtttctccaaactcaaatgaactagtttccacacaaaaaacactagcaaagttccttaaaccatgttccaaaaacactcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40740690 |
ttctcgtattgcaacattggtttctccaaactcacatgaactagtttccacacaaaaaacactagcaaagttccttaaaccatgttccaaaaacactcca |
40740789 |
T |
 |
| Q |
201 |
agtccaacattgcatcattctgaaacagtgtctcaaatgaactatcttcatcctaagaaacttaacttcaaaggttggaaaaatcctcaagcaaaatggg |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40740790 |
------acattgcatcattccgaaacagtgtctcaaatgaaccatcttcatcctaagaaacttaacttcaaaggttggaaaaatcctcaagcaaaatggg |
40740883 |
T |
 |
| Q |
301 |
gtgattggtttgaaacattaacaggaaaacatggtttcatatggaaccaaacaggtctctgtg |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40740884 |
gtgattggtttgaaacattaacaggaaaacatggtttcatatggaaccaaacaggtctctgtg |
40740946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University