View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14307_low_77 (Length: 304)

Name: NF14307_low_77
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14307_low_77
NF14307_low_77
[»] chr6 (1 HSPs)
chr6 (13-77)||(5679836-5679902)


Alignment Details
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 77
Target Start/End: Original strand, 5679836 - 5679902
Alignment:
13 aacctgtgcatgccttgcaaccctcaaattttaagtcacaacgtagtaaagt--aatattaaaacat 77  Q
    |||| |||||||| ||||||||||||||||||||||||||||||||||||||  |||||||||||||    
5679836 aaccggtgcatgctttgcaaccctcaaattttaagtcacaacgtagtaaagtaaaatattaaaacat 5679902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University