View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_77 (Length: 304)
Name: NF14307_low_77
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_77 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 77
Target Start/End: Original strand, 5679836 - 5679902
Alignment:
| Q |
13 |
aacctgtgcatgccttgcaaccctcaaattttaagtcacaacgtagtaaagt--aatattaaaacat |
77 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5679836 |
aaccggtgcatgctttgcaaccctcaaattttaagtcacaacgtagtaaagtaaaatattaaaacat |
5679902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University