View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_78 (Length: 304)
Name: NF14307_low_78
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 55145069 - 55144784
Alignment:
| Q |
1 |
ggctgagcaaggagtggatccacagcatacatctccatgtcaaacatcctaaacatgagtcttggattttgtgcaggaccagcaccttcaccacaactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55145069 |
ggctgagcaaggagtggatccacagcatacatctccatgtcaaacatcctaaacatgagtcttggattttgtgcaggaccagcaccttcaccacaactca |
55144970 |
T |
 |
| Q |
101 |
ttggtcctccttgtatattattacttcctgagacatgtgcagaacaaccacctaagtctggtgctccatcaaacctcattgtatagcttccaaaccaatt |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55144969 |
ttggtcctccttgtctattattacttcctgagacatgtgcagaacaaccacctaagtctggtgctccatcaaacctcattgtatagcttccaaaccaatt |
55144870 |
T |
 |
| Q |
201 |
tgttgtttcttctcttgacattgttacttgcccattgctgtcactacatgacagagttacttttgcacctgcattaaatttggtca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55144869 |
tgttgtttcttctcttgacattgttacttgcccattgctgtcactacatgacagagttacttttgcacctgcattaaatttggtca |
55144784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University