View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_79 (Length: 298)
Name: NF14307_low_79
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_79 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 217 - 288
Target Start/End: Complemental strand, 48706762 - 48706691
Alignment:
| Q |
217 |
ctcttctgcacatctaaatttacaaagagggtaaatgtgatgtacataaaaaacgcgtttgagacagaatta |
288 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48706762 |
ctcttctacacatctaaatttacaaagagggtaaatgtgacgtacataaaaaacgcgtttgagacagaatta |
48706691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University