View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_83 (Length: 284)
Name: NF14307_low_83
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_83 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 264
Target Start/End: Original strand, 330047 - 330303
Alignment:
| Q |
8 |
accaatagattgcaagtctctgtattttgctattttacataaaatattaagaattaccaacaatggaatgtgcaaaatttcaatttgataggagaaattg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
330047 |
accaatagattgcaagtctctgtattttactattttacataaaatattaagaattaccagtaatggaatgtgcaaaatttcaatttgatgggagaaattg |
330146 |
T |
 |
| Q |
108 |
ttctatttgtaactgtatgcatctataaacacatttcttttgatgagaatcataagtattggattttgtttgcttgtttagtatttgtttcaaatcttaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
330147 |
ttctatttgtaactgtatgcatctataaacacatttcttttgatgagaatcataagtattggattttgtttgcttgtttagtatttgtttcaaatcttaa |
330246 |
T |
 |
| Q |
208 |
gtatttaaaacacatgaagttagtgtgaccttgattgcaacctaagagcacttaagc |
264 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
330247 |
gtatttaaaacacatgaagttagtgtggccttgattgcaacctaagagcacttaagc |
330303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University