View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_92 (Length: 252)
Name: NF14307_low_92
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_92 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 30784263 - 30784049
Alignment:
| Q |
16 |
attattctatgctattattggaatttttggggggaatatggttttttaaaagtgtgtttttatctcatattagctttcaaataattgaaggttattgata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30784263 |
attattctatgctattattggaatttttggggggagtatggtttttaaaaagtgtgtttttatctcatattagctttcaaataattgaaggttattgata |
30784164 |
T |
 |
| Q |
116 |
tgactggtgattaattaactaattgatagttatgttaattagttataggcagattatggacatagaactgattttggatttcaactgacttatataaaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30784163 |
tgactggtgattaattaactaattgatagttatgttaattagttataggcagattattgacatagaactgattttggatttcaactgacttatataaaaa |
30784064 |
T |
 |
| Q |
216 |
tactataggagcgta |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30784063 |
tactataggagcgta |
30784049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University