View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_94 (Length: 250)
Name: NF14307_low_94
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 16 - 174
Target Start/End: Complemental strand, 35476008 - 35475850
Alignment:
| Q |
16 |
atacggtaaatacaaaatactttcaatggctcaaattcaaaccccctaaacattccgaagtgttaaacgaatcaaaacttgacagacaatgttaagaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35476008 |
atacggtaaatacaaaatactttcaatggctcaaattcaaaccccctaaacattccgaagtgttaaacgaatcaaaacttgacagacaatgttaagaaat |
35475909 |
T |
|
| Q |
116 |
acaagaggatcatgagatctctttttataatatatggaatctttttatgagatctcttt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35475908 |
acaagaggatcatgagatctctttttataatatatggaatctttttatgagatctcttt |
35475850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 176 - 250
Target Start/End: Complemental strand, 35475820 - 35475746
Alignment:
| Q |
176 |
tatttctcgaccaactaacattagaggggaataagcaactatatgtctttttaggtgtcttcataaacgtgaata |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35475820 |
tatttctcgaccaactaacattagaggggaataagcaactatatgtctttttaggtgtcttcataaacgtgaata |
35475746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University