View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14307_low_96 (Length: 250)
Name: NF14307_low_96
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14307_low_96 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 45427840 - 45428077
Alignment:
| Q |
13 |
aatatagtacattgaacacatttatgacatgaatcatgataaaatgttaaaaactttatggtagaaacatagnnnnnnnccattccgggactcttagctc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45427840 |
aatatagtacattgaacacatttatgacatgaatcatgataaaatgttaaaaactttatggtagaaacatagaaaaaaaccattccgggactcttagctc |
45427939 |
T |
 |
| Q |
113 |
actgttaagattataagtcaactggaccacaacttgataccttaatactataaagaagtctttgcagtaagtctatgcatattagtccacaatttgagtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45427940 |
actgttaagattataagtcaactggaccacaacttgataccttaatactataaagaagtctttgcagtaagtctataaatattagtccacaatttgagtc |
45428039 |
T |
 |
| Q |
213 |
caaggatttacttaaagttgcacgatagggatataaat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45428040 |
caaggatttacttaaagttgcacgatagggatataaat |
45428077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University