View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14308_low_11 (Length: 284)
Name: NF14308_low_11
Description: NF14308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14308_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 38816651 - 38816477
Alignment:
| Q |
1 |
tagttatattcgtgaatcgtgatagtgttggagactgacatctgttggacactggacacacctttaatatgaagtctcggtgctagatatttatgggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816651 |
tagttatattcgtgaatcgtgatagtgttggagactgacatctgttggacactgcacacacctttaatatgaagtctcggtgctagatatttatgggaga |
38816552 |
T |
 |
| Q |
101 |
tatttatttgtgaagtttctttctaaggctttcttgttgtgtgttcaggtgaagatttgagtgatcttgctgtgg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816551 |
tatttatttgtgaagtttctttctaaggctttcttgttgtgtgttcaggtgaagatttgagtgatcttgctgtgg |
38816477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 173 - 279
Target Start/End: Complemental strand, 38815326 - 38815220
Alignment:
| Q |
173 |
tggttatgtgttaggagagagcgtctatttcttttgtttgaggagtggttaattaattctctcttttaagttggggttttctgtttaggtgttatgttac |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815326 |
tggttatgtgttaggagagagcgtctatttcttttgtttgaggagtggttaattaattctctcttttaagttggggttttctgtttaggtgttatgttac |
38815227 |
T |
 |
| Q |
273 |
ctatgct |
279 |
Q |
| |
|
||||||| |
|
|
| T |
38815226 |
ctatgct |
38815220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 175
Target Start/End: Complemental strand, 38821928 - 38821888
Alignment:
| Q |
135 |
tgttgtgtgttcaggtgaagatttgagtgatcttgctgtgg |
175 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
38821928 |
tgttgtgtgtccaggtgaagatttgagcgatcttgctgtgg |
38821888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 35665597 - 35665559
Alignment:
| Q |
26 |
tgttggagactgacatctgttggacactggacacacctt |
64 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35665597 |
tgttggaaactgacatgtgttggacactggacacacctt |
35665559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University