View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14308_low_12 (Length: 284)
Name: NF14308_low_12
Description: NF14308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14308_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 12 - 268
Target Start/End: Original strand, 51936849 - 51937095
Alignment:
| Q |
12 |
gaagaatatcgatatctgctacatgtacaaacggatgtgttccctatttggacttcatagataatgggataatgatctggttatggcctaaggttgtcct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51936849 |
gaagaatatcgatatctgctacatgtacaaacggatgtgttccctatttggacttcatagata--------atgatctggttatggcctaaggttgtcct |
51936940 |
T |
 |
| Q |
112 |
gacagaaaacctgcaatatgcatctacatgcagctggaatggataaagcaaaatttgatagcacaattgnnnnnnnnnnnnnnnnnntgtagtagaggtg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
51936941 |
gacagaaaacctgcaatatgcatctacatgcagctggaatggataaagcacaatttgatagcacaattg--aaaaaaaaaataaaaatgtagtagaggtg |
51937038 |
T |
 |
| Q |
212 |
agactaattgaaaggaaatttctttgaaggactaattgaaagtaaattgttataagt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937039 |
agactaattgaaaggaaatttctttgaaggactaattgaaagtaaattgttataagt |
51937095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University