View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14308_low_14 (Length: 235)
Name: NF14308_low_14
Description: NF14308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14308_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 156
Target Start/End: Original strand, 45982978 - 45983115
Alignment:
| Q |
19 |
gttgagaacttcgttgaagaagagttgtggattcagattcatcaccgattcaaaaacggcctcgctctcacttccttccattcccgccacaattcgattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45982978 |
gttgagaacttcgttgaagaagagttgtggattcagattcatcaccgattcaaaaacggcctcgctctcacttccttccattcccgccacaattcgattc |
45983077 |
T |
|
| Q |
119 |
ccaaaatttcagttcaacagcacaatgatggaaatatt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45983078 |
ccaaaatttcagttcaacagcacaatgatggaaatatt |
45983115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 45868029 - 45867961
Alignment:
| Q |
19 |
gttgagaacttcgttgaagaagagttgtggattcagattcatcaccgattcaaaaacggcctcgctctc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| || |||||||| |
|
|
| T |
45868029 |
gttgagaacttcgttgaagaagagttgtggattcaaattcatcaccgattcgaaaatcgcatcgctctc |
45867961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University