View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14309_high_1 (Length: 664)
Name: NF14309_high_1
Description: NF14309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14309_high_1 |
 |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-100; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 137 - 379
Target Start/End: Original strand, 30676779 - 30677021
Alignment:
| Q |
137 |
atcaaatttgtaagcatcnnnnnnngacatatcattcaatagagaaatatttgtatggtcacagttctaaataaaaattatttagatatgcttgttaaaa |
236 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
30676779 |
atcaaatttgtaagcatctttttttgacatatcattcaatagagaaatatttgtatggtcacagttctaactaaaaattatttagatatgcttgttcaaa |
30676878 |
T |
 |
| Q |
237 |
taaaatatttaggtatgttctggaccgacataatgcccaataagaacggctcaacaagccgagactcatatcattcagaagacaacaatttgaaggtgca |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
30676879 |
taaaatatttaggtatgttctggaccgacatgatgtccaataagaacggctcaacaagccgagactcatatcattcggaaggcaacaattcgaaggtgca |
30676978 |
T |
 |
| Q |
337 |
tgtgaagccatgtgcggcttaccgcacaagagcatgttcggat |
379 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
30676979 |
tgtgaagccatgtgtggcttaccgcacaagagcacgttcggat |
30677021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 30676543 - 30676656
Alignment:
| Q |
18 |
aacaatagtagtacactactagatgtacgtgaaaaacagatttgcaggtggtgagtagtgactagtcgtcgaggatgatgaagctgaaccacgatctacc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30676543 |
aacaatagtagtacactactagatgtacgtgaaaaacagatttgcaggtggtgagtagtgactagtcgtcgagaatgatgaagctgaaccacgatctacc |
30676642 |
T |
 |
| Q |
118 |
ctaacctcaacaac |
131 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
30676643 |
ctaacgtcaacaac |
30676656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 380 - 452
Target Start/End: Original strand, 30677071 - 30677150
Alignment:
| Q |
380 |
caaatcccatatgtagttatcaacgttctcgtc-------gtatgattcagtgtcacgttttatagatatagttcactca |
452 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
30677071 |
caaatcccatatgtagttatcaacgttctcgtctatacaagcatgattcagtgtcacattttatagataccgttcactca |
30677150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 598 - 645
Target Start/End: Complemental strand, 587318 - 587271
Alignment:
| Q |
598 |
aattcagattttaacttttcatattctctcttgaagctctcagtccca |
645 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
587318 |
aatttagattttaacttttcatcttctctcttggagctctcagtccca |
587271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 467 - 514
Target Start/End: Original strand, 3191 - 3238
Alignment:
| Q |
467 |
caatccacctctttcacatattggcttgagcgttgcagtggtaacgta |
514 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |||| ||||||| |
|
|
| T |
3191 |
caatccacctctttcatatattgacttgagcgttggagtgctaacgta |
3238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 464 - 518
Target Start/End: Original strand, 39832569 - 39832623
Alignment:
| Q |
464 |
acacaatccacctctttcacatattggcttgagcgttgcagtggtaacgtacctg |
518 |
Q |
| |
|
||||||| ||||||||||||||| || ||||||| ||| ||||||||||| |||| |
|
|
| T |
39832569 |
acacaattcacctctttcacatagtgacttgagcattggagtggtaacgtgcctg |
39832623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 457 - 513
Target Start/End: Original strand, 30808637 - 30808693
Alignment:
| Q |
457 |
ttttcatacacaatccacctctttcacatattggcttgagcgttgcagtggtaacgt |
513 |
Q |
| |
|
|||||| ||||||||||||||||||||||| | |||||| |||| |||| |||||| |
|
|
| T |
30808637 |
ttttcacacacaatccacctctttcacataccgacttgagtgttggagtgctaacgt |
30808693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University