View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14309_high_22 (Length: 265)
Name: NF14309_high_22
Description: NF14309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14309_high_22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 47455324 - 47455571
Alignment:
| Q |
18 |
cttttcctcttagaagacttccaagaaaaatggaaacacttggagctatccctgatgatggtgaatgggaatgctttcgcagaatatttgacaccgacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47455324 |
cttttcctcttagaagacttccaagaaaaatggaaacacttggagctatccctgatgatggtgaatgggaatgctttcgcagaatatttgacaccgacaa |
47455423 |
T |
|
| Q |
118 |
ccacgatgactctccaccgcaattacttgatcaaacctcgcttctgcttggggaaaatgatgggaactttggagtacaatccatgttttgctccccttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47455424 |
ccacgatgactctccaccgcaattacttgatcaaacctcgcttctgcttggggaaaatgatgggaactttggagtacaatccatgttttgctccccttct |
47455523 |
T |
|
| Q |
218 |
gaagctgagggaaatattaatactaatgtgttttactcctttgcttct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
47455524 |
gaagctgagggaaatattaatactaatgtgttttactcttttgattct |
47455571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University