View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14309_high_24 (Length: 254)
Name: NF14309_high_24
Description: NF14309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14309_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 35272824 - 35273044
Alignment:
| Q |
17 |
ataaagataataacaaattttgcaccgatctttctttcaaaaaacaaacttttcaccgatattaaatcgcttatttatacttgttttaaaaaccctaatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35272824 |
ataaagataataacaaattttgcaccgatctttctttcaaaaaacaaacttttcaccgatattaaatcgcttatttatacttgtttgaaaaaccctaatc |
35272923 |
T |
 |
| Q |
117 |
atattttctggcgctctcttcataacaaatcttttcttctcttccaatagctttatcgctt--cccatggatcctcaggaacccaaacgtgttgatcgag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35272924 |
atattttctggcgctctcttcataacaaatcttttcttctcttccaatagctttatcgcttcccccatggatcctcaggaacccaaacgcgttgatcgag |
35273023 |
T |
 |
| Q |
215 |
aaatctggcagtgcttggccg |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35273024 |
aaatctggcagtgcttggccg |
35273044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University