View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14309_low_21 (Length: 284)
Name: NF14309_low_21
Description: NF14309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14309_low_21 |
 |  |
|
| [»] scaffold0713 (1 HSPs) |
 |  |  |
|
| [»] scaffold0264 (1 HSPs) |
 |  |  |
|
| [»] scaffold1092 (1 HSPs) |
 |  |  |
|
| [»] scaffold1058 (1 HSPs) |
 |  |  |
|
| [»] scaffold0362 (1 HSPs) |
 |  |  |
|
| [»] scaffold0084 (1 HSPs) |
 |  |  |
|
| [»] scaffold0566 (1 HSPs) |
 |  |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
| [»] scaffold0150 (2 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0916 (1 HSPs) |
 |  |  |
|
| [»] scaffold0816 (1 HSPs) |
 |  |  |
|
| [»] scaffold0773 (1 HSPs) |
 |  |  |
|
| [»] scaffold0673 (1 HSPs) |
 |  |  |
|
| [»] scaffold0607 (1 HSPs) |
 |  |  |
|
| [»] scaffold0560 (1 HSPs) |
 |  |  |
|
| [»] scaffold0489 (1 HSPs) |
 |  |  |
|
| [»] scaffold0230 (2 HSPs) |
 |  |  |
|
| [»] scaffold0215 (1 HSPs) |
 |  |  |
|
| [»] scaffold0211 (1 HSPs) |
 |  |  |
|
| [»] scaffold0146 (1 HSPs) |
 |  |  |
|
| [»] scaffold0111 (1 HSPs) |
 |  |  |
|
| [»] scaffold0075 (1 HSPs) |
 |  |  |
|
| [»] scaffold0071 (2 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0029 (2 HSPs) |
 |  |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0861 (1 HSPs) |
 |  |  |
|
| [»] scaffold0630 (1 HSPs) |
 |  |  |
|
| [»] scaffold0261 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0165 (1 HSPs) |
 |  |  |
|
| [»] scaffold0076 (1 HSPs) |
 |  |  |
|
| [»] scaffold0037 (1 HSPs) |
 |  |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0674 (1 HSPs) |
 |  |  |
|
| [»] scaffold0098 (1 HSPs) |
 |  |  |
|
| [»] scaffold0192 (1 HSPs) |
 |  |  |
|
| [»] scaffold0624 (1 HSPs) |
 |  |  |
|
| [»] scaffold0278 (1 HSPs) |
 |  |  |
|
| [»] scaffold0213 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0471 (1 HSPs) |
 |  |  |
|
| [»] scaffold0125 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 33)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 89 - 274
Target Start/End: Complemental strand, 52168227 - 52168041
Alignment:
| Q |
89 |
aagacatacgtgaaccaaggagtgatagggggaaatgtcattatgacaatttaacaaattagtcgactgatataaaaattgtcaaatcatgtggaataca |
188 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52168227 |
aagacatgcgtgaaccaaggagtgatagggggaaatgtcattatgacaatttaacaaattagtcgactcatataaaaattgtcaaatcatgtggaataca |
52168128 |
T |
 |
| Q |
189 |
ggcgtgcaccaatgagtgataggtgaaatccatcgcaattactcagattataaaagc-aaaatcattcatttctagtctgagatatt |
274 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52168127 |
ggcgtccaccaatgagtgataggggaaatccatcgcaattactcagattataaaagcaaaaatcattcatttctagtctgagatatt |
52168041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 52169212 - 52169147
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52169212 |
ttatataaaactagggtttatggtttggtttgattaggattatgtcattagacttatgcaacaatc |
52169147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 22411329 - 22411273
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttat |
74 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
22411329 |
ttatataaaactagggtttatggtttggtttgattaggattacgtcattagacttat |
22411273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 16354301 - 16354236
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | || |||| ||||| |||||||||||||| |||||||| |
|
|
| T |
16354301 |
ttatataaaactagggtttatggtttggttaaattaagattacgtcattagacttatccaacaatc |
16354236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 17986752 - 17986713
Alignment:
| Q |
44 |
gatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17986752 |
gatttgattaggattatgtcattagacttatccaacaatc |
17986713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 79
Target Start/End: Complemental strand, 16431768 - 16431706
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaac |
79 |
Q |
| |
|
|||| |||||| ||||||||| | | ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16431768 |
gttacataaaattagggtttaaagcttgatttgattaggattatgtcattagacttatccaac |
16431706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 39286512 - 39286566
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||| || ||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39286512 |
tagggttaatagtttggtttgattaggattatgtcattagacttatccaacaatc |
39286566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 2386420 - 2386383
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2386420 |
tttgattaggattatgtcattagacttatccaacaatc |
2386383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 3985448 - 3985411
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3985448 |
tttgattaggattatgtcattagacttatccaacaatc |
3985411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 3990727 - 3990690
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3990727 |
tttgattaggattatgtcattagacttatccaacaatc |
3990690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 8649059 - 8649022
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8649059 |
tttgattaggattatgtcattagacttatccaacaatc |
8649022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 13250928 - 13250891
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13250928 |
tttgattaggattatgtcattagacttatccaacaatc |
13250891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 16485469 - 16485432
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16485469 |
tttgattaggattatgtcattagacttatccaacaatc |
16485432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 19875033 - 19875070
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19875033 |
tttgattaggattatgtcattagacttatccaacaatc |
19875070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 25727142 - 25727105
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25727142 |
tttgattaggattatgtcattagacttatccaacaatc |
25727105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 25735550 - 25735513
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25735550 |
tttgattaggattatgtcattagacttatccaacaatc |
25735513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 27041876 - 27041839
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27041876 |
tttgattaggattatgtcattagacttatccaacaatc |
27041839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 27047630 - 27047593
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27047630 |
tttgattaggattatgtcattagacttatccaacaatc |
27047593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 27911227 - 27911264
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27911227 |
tttgattaggattatgtcattagacttatccaacaatc |
27911264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 36850253 - 36850290
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36850253 |
tttgattaggattatgtcattagacttatccaacaatc |
36850290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 38045527 - 38045490
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38045527 |
tttgattaggattatgtcattagacttatccaacaatc |
38045490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 41802465 - 41802428
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41802465 |
tttgattaggattatgtcattagacttatccaacaatc |
41802428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 46143439 - 46143476
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46143439 |
tttgattaggattatgtcattagacttatccaacaatc |
46143476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 49379542 - 49379579
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49379542 |
tttgattaggattatgtcattagacttatccaacaatc |
49379579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 52755244 - 52755281
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52755244 |
tttgattaggattatgtcattagacttatccaacaatc |
52755281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 18816548 - 18816512
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18816548 |
ttgattaggattatgtcattagacttatccaacaatc |
18816512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 81
Target Start/End: Complemental strand, 41461918 - 41461883
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41461918 |
tttgattaggattatgtcattagacttatccaacaa |
41461883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 19788150 - 19788216
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||| ||||||||| | | ||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
19788150 |
gttatataaaattagggtttaaaacttggtttgattaggattatgtcattagacatatccaacaatc |
19788216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 28208094 - 28208040
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| || | | ||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
28208094 |
tagggtttaaggcttggtttgattaggattatgtcattagacttatccaagaatc |
28208040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 16365198 - 16365235
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16365198 |
tttgattaggattatgtcattagacttatctaacaatc |
16365235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 79
Target Start/End: Complemental strand, 17716940 - 17716907
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaac |
79 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
17716940 |
tttgattaggattatgtcattagacttatccaac |
17716907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 19772099 - 19772136
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
19772099 |
tttgattaggattatgtcattagacttatacgacaatc |
19772136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 48256491 - 48256454
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
48256491 |
tttgattaggattatgtcattagacttatccaataatc |
48256454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 5e-31; HSPs: 73)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 138 - 274
Target Start/End: Complemental strand, 19328414 - 19328279
Alignment:
| Q |
138 |
tttaacaaattagtcgactgatataaaaattgtcaaatcatgtggaatacaggcgtgcaccaatgagtgataggtgaaatccatcgcaattactcagatt |
237 |
Q |
| |
|
|||||||||||||| ||| |||||| | |||||||||||||||| |||| || |||| |||||||||||||||| | |||||||||||||||||| || |
|
|
| T |
19328414 |
tttaacaaattagttgaccgatatacatattgtcaaatcatgtgcaatagag-cgtgtaccaatgagtgatagggggaatccatcgcaattactcgaatg |
19328316 |
T |
 |
| Q |
238 |
ataaaagcaaaatcattcatttctagtctgagatatt |
274 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19328315 |
ataaaagcaaaatcatttctttctggtctgagatatt |
19328279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 4090921 - 4090856
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
4090921 |
ttatataaaactagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
4090856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 33609945 - 33609880
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33609945 |
ttatataaaattagggtttatggtttggtttgattaggattatgtcattagacttatccaacaatc |
33609880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 39388955 - 39388890
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
39388955 |
ttatataaaactagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
39388890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 8780315 - 8780380
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
8780315 |
ttatataaaattagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
8780380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 8787154 - 8787219
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
8787154 |
ttatataaaattagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
8787219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 9562153 - 9562091
Alignment:
| Q |
21 |
tataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
9562153 |
tataaaattagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
9562091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 6257392 - 6257457
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
6257392 |
ttatataaaattagggtttatggtttggtttgattaggatttcgtcattagacttatccaacaatc |
6257457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 21005392 - 21005457
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| ||||||| |||| | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21005392 |
ttatataaaattagggttcatggcttggtttgattaggattatgtcattagacttatccaacaatc |
21005457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 3376381 - 3376447
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3376381 |
gttacataaaattagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
3376447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 9193884 - 9193949
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| ||| |||||||||| | |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
9193884 |
ttatataaaattagagtttatggtttggtttgattaggattacgtcattagacttacccaacaatc |
9193949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 19328137 - 19328084
Alignment:
| Q |
221 |
tcgcaattactcagattataaaagcaaaatcattcatttctagtctgagatatt |
274 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19328137 |
tcgcaattacttagatgataaaagcaaaatcattcctttctggtctgagatatt |
19328084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 41722886 - 41722849
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41722886 |
tttgattaggattatgtcattagacttatgcaacaatc |
41722849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 14545620 - 14545581
Alignment:
| Q |
44 |
gatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14545620 |
gatttgattaggattatgtcattagacttatccaacaatc |
14545581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 14551860 - 14551821
Alignment:
| Q |
44 |
gatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14551860 |
gatttgattaggattatgtcattagacttatccaacaatc |
14551821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 19515238 - 19515292
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| | |||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
19515238 |
tagggtttatggtttggtttgattaggattacgtcattagacttatccaagaatc |
19515292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 48713669 - 48713603
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
48713669 |
gttacataaaattagggtttaaggcttggtttgattacgattatgtcattagacttatccaacaatc |
48713603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 82
Target Start/End: Complemental strand, 368330 - 368265
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
|||| |||||| ||||||||| || | || ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
368330 |
gttacataaaattagggtttaaggcttgacttgattaggattatgtcattatacttattcaacaat |
368265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 538162 - 538199
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
538162 |
tttgattaggattatgtcattagacttatccaacaatc |
538199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 545036 - 545073
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
545036 |
tttgattaggattatgtcattagacttatccaacaatc |
545073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 821430 - 821393
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
821430 |
tttgattaggattatgtcattagacttatccaacaatc |
821393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 826443 - 826406
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
826443 |
tttgattaggattatgtcattagacttatccaacaatc |
826406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 828454 - 828417
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
828454 |
tttgattaggattatgtcattagacttatccaacaatc |
828417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 82
Target Start/End: Complemental strand, 1614194 - 1614129
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
|||| |||||| ||||||||| | | | ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1614194 |
gttacataaaattagggtttaaagcttggtttgattaggattatgtcattagacttatccaacaat |
1614129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 4158577 - 4158614
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4158577 |
tttgattaggattatgtcattagacttatccaacaatc |
4158614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 4466559 - 4466596
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4466559 |
tttgattaggattatgtcattagacttatccaacaatc |
4466596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 5840860 - 5840823
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5840860 |
tttgattaggattatgtcattagacttatccaacaatc |
5840823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 8713178 - 8713141
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8713178 |
tttgattaggattatgtcattagacttatccaacaatc |
8713141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 8718682 - 8718645
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8718682 |
tttgattaggattatgtcattagacttatccaacaatc |
8718645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 9004807 - 9004770
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9004807 |
tttgattaggattatgtcattagacttatccaacaatc |
9004770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 9009792 - 9009755
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9009792 |
tttgattaggattatgtcattagacttatccaacaatc |
9009755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 9258528 - 9258565
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9258528 |
tttgattaggattatgtcattagacttatccaacaatc |
9258565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 9311725 - 9311688
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9311725 |
tttgattaggattatgtcattagacttatccaacaatc |
9311688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 11997206 - 11997271
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||||| || | ||||||||||| |||||||| |
|
|
| T |
11997206 |
ttatataaaactagggtttatgctttggtttgattaggaataaattattagacttatccaacaatc |
11997271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 12548210 - 12548247
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12548210 |
tttgattaggattatgtcattagacttatccaacaatc |
12548247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14229853 - 14229890
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14229853 |
tttgattaggattatgtcattagacttatccaacaatc |
14229890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 15061443 - 15061406
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15061443 |
tttgattaggattatgtcattagacttatccaacaatc |
15061406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 15066532 - 15066495
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15066532 |
tttgattaggattatgtcattagacttatccaacaatc |
15066495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 15916195 - 15916232
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15916195 |
tttgattaggattatgtcattagacttatccaacaatc |
15916232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 15924504 - 15924541
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15924504 |
tttgattaggattatgtcattagacttatccaacaatc |
15924541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 16330787 - 16330824
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16330787 |
tttgattaggattatgtcattagacttatccaacaatc |
16330824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 17946905 - 17946868
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17946905 |
tttgattaggattatgtcattagacttattcaacaatc |
17946868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 18389849 - 18389812
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18389849 |
tttgattaggattatgtcattagacttatccaacaatc |
18389812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 19014544 - 19014581
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19014544 |
tttgattaggattatgtcattagacttatccaacaatc |
19014581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 19364588 - 19364551
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19364588 |
tttgattaggattatgtcattagacttatccaacaatc |
19364551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 23203980 - 23203943
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23203980 |
tttgattaggattatgtcattagacttatccaacaatc |
23203943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 23510107 - 23510070
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23510107 |
tttgattaggattatgtcattagacttatccaacaatc |
23510070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 37100262 - 37100299
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37100262 |
tttgattaggattatgtcattagacttatccaacaatc |
37100299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 82
Target Start/End: Original strand, 8522055 - 8522091
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8522055 |
tttgattaggattatgtcattagacttatccaacaat |
8522091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 12562131 - 12562095
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12562131 |
ttgattaggattatgtcattagacttatccaacaatc |
12562095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 20624794 - 20624758
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20624794 |
ttgattaggattatgtcattagacttatccaacaatc |
20624758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 34390814 - 34390778
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34390814 |
ttgattaggattatgtcattagacttatccaacaatc |
34390778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 81
Target Start/End: Complemental strand, 13731977 - 13731942
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13731977 |
tttgattaggattatgtcattagacttatccaacaa |
13731942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 16897128 - 16897195
Alignment:
| Q |
17 |
gttatataaaactagggtttatgg-ttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || || | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
16897128 |
gttacataaaattagggtttaaggcttggttttgattaggattacgtcattagacttatccaacaatc |
16897195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 4294818 - 4294752
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| |||| |||||| || | | |||||||||||||||||||||||||||| | |||||| |
|
|
| T |
4294818 |
gttatataatactaaggtttaaggcttaacttgattaggattatgtcattagacttatccgacaatc |
4294752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14596 - 14633
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
14596 |
tttgattaggattatgtcatttgacttatccaacaatc |
14633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 2325740 - 2325777
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
2325740 |
tttgattaggattatgtcgttagacttatccaacaatc |
2325777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 4030199 - 4030162
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
4030199 |
tttgattaggattatgtcactagacttatccaacaatc |
4030162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 4460657 - 4460694
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4460657 |
tttgattaggattaggtcattagactcatgcaacaatc |
4460694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 9578044 - 9578007
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
9578044 |
tttgattaggattatgtcattagacttatccaataatc |
9578007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 9585470 - 9585433
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
9585470 |
tttgattaggattatgtcattagacttatccaataatc |
9585433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 83
Target Start/End: Complemental strand, 10204905 - 10204872
Alignment:
| Q |
50 |
attaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
10204905 |
attaggattatgtcattagacttatccaacaatc |
10204872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 13435060 - 13435023
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
13435060 |
tttgattaggattatgtcattagacttatccaataatc |
13435023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 16487563 - 16487526
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
16487563 |
tttgattaggattatgtcattagacttatcccacaatc |
16487526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 23515889 - 23515852
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
23515889 |
tttgattagtattatgtcattagacttatccaacaatc |
23515852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 35964128 - 35964165
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
35964128 |
tttgattaggattatctcattagacttatccaacaatc |
35964165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 39271350 - 39271313
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
39271350 |
tttgattaggattatgtcattagacttatccaccaatc |
39271313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 20627113 - 20627077
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
20627113 |
ttgattaggattatgtcattagatttatccaacaatc |
20627077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 20631004 - 20630968
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
20631004 |
ttgattaggattatgtcattagatttatccaacaatc |
20630968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 20635612 - 20635576
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
20635612 |
ttgattaggattatgtcattagatttatccaacaatc |
20635576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 20637484 - 20637448
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
20637484 |
ttgattaggattatgtcattagatttatccaacaatc |
20637448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 22578818 - 22578782
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
22578818 |
ttgattagaattatgtcattagacttatccaacaatc |
22578782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 38388051 - 38388087
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
38388051 |
ttgattatgattatgtcattagacttatccaacaatc |
38388087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 38)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 29003853 - 29003788
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29003853 |
ttatataaaactaaggtttatggtttggtttgattaggattatgtcattagacttatccaacaatc |
29003788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 24967475 - 24967410
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
24967475 |
ttatataaaactagggtttatggtttggtttgattaggattgcgtcattagacttatccaacaatc |
24967410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 1990357 - 1990422
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| || ||||||||||| | |||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
1990357 |
ttatataaaattaaggtttatggtttggtttgattaggattacgtcattagacttatccaataatc |
1990422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 21139888 - 21139823
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
21139888 |
ttatataaaattagggtttatggtttagtttgattaggattacgtcattagacttatccaaaaatc |
21139823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 22285197 - 22285131
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22285197 |
gttacataaaattagggtttaaagcttggtttgattaggattatgtcattagacttatccaacaatc |
22285131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 23455804 - 23455738
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | ||| ||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
23455804 |
gttacataaaattagggtttaaagctcggtttgactaggattatgtcattagacttatccaacaatc |
23455738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 83
Target Start/End: Complemental strand, 26013166 - 26013128
Alignment:
| Q |
45 |
atttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26013166 |
atttgattaggattatgtcattagacttatccaacaatc |
26013128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 1685847 - 1685810
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1685847 |
tttgattaggattatgtcattagacttatccaacaatc |
1685810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 6570476 - 6570513
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6570476 |
tttgattaggattatgtcattagacttatccaacaatc |
6570513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 9318029 - 9317992
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9318029 |
tttgattaggattatgtcattagacttatccaacaatc |
9317992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14351549 - 14351586
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14351549 |
tttgattaggattatgtcattagacttatccaacaatc |
14351586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14878192 - 14878229
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14878192 |
tttgattaggattatgtcattagacttatccaacaatc |
14878229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 17127028 - 17126991
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17127028 |
tttgattaggattatgtcattagacttatccaacaatc |
17126991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 19997576 - 19997539
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19997576 |
tttgattaggattatgtcattagacttatccaacaatc |
19997539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20038376 - 20038413
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20038376 |
tttgattaggattatgtcattagacttatccaacaatc |
20038413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20044031 - 20044068
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20044031 |
tttgattaggattatgtcattagacttatccaacaatc |
20044068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 21103533 - 21103570
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21103533 |
tttgattaggattatgtcattagacttatccaacaatc |
21103570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 21105575 - 21105612
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21105575 |
tttgattaggattatgtcattagacttatccaacaatc |
21105612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 21939381 - 21939418
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21939381 |
tttgattaggattatgtcattagacttatccaacaatc |
21939418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 22370740 - 22370703
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22370740 |
tttgattaggattatgtcattagacttatccaacaatc |
22370703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 23503327 - 23503290
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23503327 |
tttgattaggattatgtcattagacttatccaacaatc |
23503290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 25751604 - 25751641
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25751604 |
tttgattaggattatgtcattagacttatccaacaatc |
25751641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 29325493 - 29325456
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29325493 |
tttgattaggattatgtcattagacttatccaacaatc |
29325456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 35996276 - 35996239
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35996276 |
tttgattaggattatgtcattagacttatccaacaatc |
35996239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 43836175 - 43836212
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43836175 |
tttgattaggattatgtcattagacttatccaacaatc |
43836212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 14821378 - 14821342
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14821378 |
ttgattaggattatgtcattagacttatccaacaatc |
14821342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 82
Target Start/End: Complemental strand, 37653001 - 37652966
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37653001 |
ttgattaggattatgtcattagacttatccaacaat |
37652966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 81
Target Start/End: Original strand, 42418415 - 42418450
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42418415 |
tttgattaggattatgtcattagacttattcaacaa |
42418450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 15759781 - 15759715
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | | |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15759781 |
gttacataaaattagggtttaaagcttggtttgattaggattatgtcattagacttagccaacaatc |
15759715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 83
Target Start/End: Original strand, 11346385 - 11346418
Alignment:
| Q |
50 |
attaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
11346385 |
attaggattatgtcattagacttatccaacaatc |
11346418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 83
Target Start/End: Original strand, 11351424 - 11351457
Alignment:
| Q |
50 |
attaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
11351424 |
attaggattatgtcattagacttatccaacaatc |
11351457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 18008329 - 18008292
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
18008329 |
tttgattaggattaggtcattagacttatacaacaatc |
18008292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 18264289 - 18264326
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
18264289 |
tttgattaggattacgtcattagacttatccaacaatc |
18264326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 18273302 - 18273339
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
18273302 |
tttgattaggattacgtcattagacttatccaacaatc |
18273339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 20002932 - 20002895
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
20002932 |
tttgattaggattatgtcattaaacttatccaacaatc |
20002895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 21945316 - 21945353
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21945316 |
tttgattaggattatgtcattagacttatcaaacaatc |
21945353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 24034858 - 24034821
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
24034858 |
tttgattaggattatggcattagacttatccaacaatc |
24034821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 1302195 - 1302231
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
1302195 |
ttgattaagattatgtcattagacttatccaacaatc |
1302231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 49)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 24165473 - 24165408
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
24165473 |
ttatataaaactagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
24165408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 31757984 - 31758049
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||| | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31757984 |
ttatataaaattagggtttatggcttggtttgattaggattatgtcattagacttattcaacaatc |
31758049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 34222988 - 34223053
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
34222988 |
ttatataaaattagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
34223053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 20169340 - 20169406
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20169340 |
gttacataaaattagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
20169406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 2953402 - 2953467
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| ||||||| | || | | |||||||||||||||||||||||||| || |||||||| |
|
|
| T |
2953402 |
ttatataaaattagggttcaaggcttggtttgattaggattatgtcattagactcatccaacaatc |
2953467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 7761012 - 7761049
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7761012 |
tttgattaggattatgtcattagacttatccaacaatc |
7761049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 12322527 - 12322490
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12322527 |
tttgattaggattatgtcattagacttattcaacaatc |
12322490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 15732132 - 15732095
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15732132 |
tttgattaggattatgtcattagacttatccaacaatc |
15732095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 15736351 - 15736314
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15736351 |
tttgattaggattatgtcattagacttatccaacaatc |
15736314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 18613185 - 18613222
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18613185 |
tttgattaggattatgtcattagacttatccaacaatc |
18613222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20595227 - 20595264
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20595227 |
tttgattaggattatgtcattagacttatccaacaatc |
20595264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20601513 - 20601550
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20601513 |
tttgattaggattatgtcattagacttatccaacaatc |
20601550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20607804 - 20607841
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20607804 |
tttgattaggattatgtcattagacttatccaacaatc |
20607841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20614141 - 20614178
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20614141 |
tttgattaggattatgtcattagacttatccaacaatc |
20614178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20790120 - 20790157
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20790120 |
tttgattaggattatgtcattagacttatccaacaatc |
20790157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20795901 - 20795938
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20795901 |
tttgattaggattatgtcattagacttatccaacaatc |
20795938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20832369 - 20832406
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20832369 |
tttgattaggattatgtcattagacttatccaacaatc |
20832406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 21734514 - 21734551
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21734514 |
tttgattaggattatgtcattagacttatccaacaatc |
21734551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 21812157 - 21812194
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21812157 |
tttgattaggattatgtcattagacttatccaacaatc |
21812194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 23435516 - 23435479
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23435516 |
tttgattaggattatgtcattagacttatccaacaatc |
23435479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 23446883 - 23446846
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23446883 |
tttgattaggattatgtcattagacttatccaacaatc |
23446846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 23618373 - 23618410
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23618373 |
tttgattaggattatgtcattagacttatccaacaatc |
23618410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 23685041 - 23685004
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23685041 |
tttgattaggattatgtcattagacttatccaacaatc |
23685004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 23771115 - 23771078
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23771115 |
tttgattaggattatgtcattagacttatccaacaatc |
23771078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 23849770 - 23849807
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23849770 |
tttgattaggattatgtcattagacttatccaacaatc |
23849807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 23973107 - 23973144
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23973107 |
tttgattaggattatgtcattagacttatccaacaatc |
23973144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 24935662 - 24935625
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24935662 |
tttgattaggattatgtcattagacttatccaacaatc |
24935625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 24941354 - 24941317
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24941354 |
tttgattaggattatgtcattagacttatccaacaatc |
24941317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 26848462 - 26848425
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26848462 |
tttgattaggattatgtcattagacttatccaacaatc |
26848425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 34780500 - 34780463
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34780500 |
tttgattaggattatgtcattagacttatccaacaatc |
34780463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 41765684 - 41765721
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41765684 |
tttgattaggattatgtcattagacttatccaacaatc |
41765721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 17408598 - 17408662
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaa |
81 |
Q |
| |
|
|||| |||||| ||||||||| | | | ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17408598 |
gttacataaaattagggtttaaagctgggtttgattaggattatgtcattagacttatccaacaa |
17408662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 82
Target Start/End: Complemental strand, 21382470 - 21382434
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21382470 |
tttgattaggattatgtcattagacttatccaacaat |
21382434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 82
Target Start/End: Complemental strand, 23756947 - 23756911
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23756947 |
tttgattaggattatgtcattagacttatccaacaat |
23756911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 82
Target Start/End: Complemental strand, 23822403 - 23822367
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23822403 |
tttgattaggattatgtcattagacttatccaacaat |
23822367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 25741876 - 25741840
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25741876 |
ttgattaggattatgtcattagacttatccaacaatc |
25741840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 20915823 - 20915889
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | | ||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
20915823 |
gttacataaaattagggtttaaagcttggtttgattaggattttgtcattagacttatccaacaatc |
20915889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 14482573 - 14482536
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
14482573 |
tttgattaggattatgtcattagacttatccaaaaatc |
14482536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 18067422 - 18067385
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
18067422 |
tttgattaggattatgtcattagacttatccaataatc |
18067385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 18073717 - 18073680
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
18073717 |
tttgattaggattatgtcattagacttatccaataatc |
18073680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20724743 - 20724780
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
20724743 |
tttgattaggataatgtcattagacttatccaacaatc |
20724780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 21389863 - 21389826
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
21389863 |
tttgattaggattatatcattagacttatccaacaatc |
21389826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 22942577 - 22942516
Alignment:
| Q |
22 |
ataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||| ||||||||| ||| | ||||| ||||||||||||||||||||||| | |||||| |
|
|
| T |
22942577 |
ataaaattagggtttaaagtttggtttgactaggattatgtcattagacttatccgacaatc |
22942516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 28834805 - 28834842
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
28834805 |
tttgattaagattatgtcattagacttatccaacaatc |
28834842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 30730033 - 30729996
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
30730033 |
tttgattaggattatgtcattaggcttatccaacaatc |
30729996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 42789732 - 42789769
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
42789732 |
tttgattaggattatgtcattagacttatccagcaatc |
42789769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 83
Target Start/End: Complemental strand, 21833134 - 21833082
Alignment:
| Q |
31 |
gggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||| || | ||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
21833134 |
gggtttaaggcttgattttattaggaatatgtcattagacttatccaacaatc |
21833082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 82
Target Start/End: Complemental strand, 26843006 - 26842970
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
26843006 |
tttgattaggattatgtcattatacttatccaacaat |
26842970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 35307544 - 35307580
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
35307544 |
ttgattaggattatgtcattagacttatccaataatc |
35307580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 30)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 12808050 - 12808115
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
12808050 |
ttatataaaactagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
12808115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 10731360 - 10731294
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10731360 |
gttacataaaattagggtttaaagcttgatttgattaggattatgtcattagacttatccaacaatc |
10731294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 10945129 - 10945063
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10945129 |
gttacataaaattagggtttaaagcttgatttgattaggattatgtcattagacttatccaacaatc |
10945063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 39604 - 39669
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
39604 |
ttatataaaattagggtttatggtttcgtttgattaggattacgtcattagacctatccaacaatc |
39669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 23 - 83
Target Start/End: Complemental strand, 9857423 - 9857363
Alignment:
| Q |
23 |
taaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||| ||||||||| ||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9857423 |
taaaattagggtttaaagtttggtttgattaggattatgtcattagacttatccaacaatc |
9857363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 18080835 - 18080889
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| ||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18080835 |
tagggtttaaagtttggtttgattaggattatgtcattagacttatccaacaatc |
18080889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 39043369 - 39043423
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39043369 |
tagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
39043423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 3371809 - 3371772
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3371809 |
tttgattaggattatgtcattagacttatccaacaatc |
3371772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 3392134 - 3392097
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3392134 |
tttgattaggattatgtcattagacttatccaacaatc |
3392097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 3419247 - 3419210
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3419247 |
tttgattaggattatgtcattagacttatccaacaatc |
3419210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 5717578 - 5717541
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5717578 |
tttgattaggattatgtcattagacttatccaacaatc |
5717541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 6518562 - 6518525
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6518562 |
tttgattaggattatgtcattagacttatccaacaatc |
6518525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 9945131 - 9945094
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9945131 |
tttgattaggattatgtcattagacttatccaacaatc |
9945094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 10631558 - 10631521
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10631558 |
tttgattaggattatgtcattagacttatccaacaatc |
10631521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14653383 - 14653420
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14653383 |
tttgattaggattatgtcattagacttatccaacaatc |
14653420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14690732 - 14690769
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14690732 |
tttgattaggattatgtcattagacttatccaacaatc |
14690769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 16683551 - 16683514
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16683551 |
tttgattaggattatgtcattagacttatccaacaatc |
16683514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 18078870 - 18078833
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18078870 |
tttgattaggattatgtcattagacttatccaacaatc |
18078833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 26811314 - 26811277
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26811314 |
tttgattaggattatgtcattagacttatccaacaatc |
26811277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 36654253 - 36654290
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36654253 |
tttgattaggattatgtcattagacttatccaacaatc |
36654290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 3772059 - 3772122
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
|||||||||| || ||||||||||| | |||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
3772059 |
ttatataaaa-taaggtttatggtttggtttgattaggattacgtcataagacttatccaacaat |
3772122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 11888881 - 11888917
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11888881 |
ttgattaggattatgtcattagacttatccaacaatc |
11888917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 48 - 83
Target Start/End: Complemental strand, 17996324 - 17996289
Alignment:
| Q |
48 |
tgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17996324 |
tgattaggattatgtcattagacttatccaacaatc |
17996289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 11902491 - 11902557
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | | ||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
11902491 |
gttacataaaattagggtttaaagcttggtttgattaggattatatcattagacttatccaacaatc |
11902557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 8091797 - 8091834
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
8091797 |
tttgattaggattttgtcattagacttatccaacaatc |
8091834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 13622483 - 13622446
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
13622483 |
tttgattaggattttgtcattagacttatccaacaatc |
13622446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 79
Target Start/End: Original strand, 16953805 - 16953838
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaac |
79 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
16953805 |
tttgattaggattatgtcattagacttatccaac |
16953838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 15866326 - 15866290
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
15866326 |
ttgattaggattatgtcattagatttatccaacaatc |
15866290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 16227231 - 16227195
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
16227231 |
ttgattaggattatctcattagacttatccaacaatc |
16227195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 24125129 - 24125165
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
24125129 |
ttgattaggattatatcattagacttatccaacaatc |
24125165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 60)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 10850587 - 10850652
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
10850587 |
ttatataaaactagggtttatggtttggtttgattaggattatgtcattagaattatccaacaatc |
10850652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 6237074 - 6237009
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| ||| || ||||||||||| |||||||| |
|
|
| T |
6237074 |
ttatataaaactagggtttatggtttggtttgattaggtttacgttattagacttatccaacaatc |
6237009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 14347947 - 14348013
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14347947 |
gttacataaaattagggtttaagacttgatttgattaggattatgtcattagacttatccaacaatc |
14348013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 1993672 - 1993607
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||||||||||||| || | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
1993672 |
ttatttaaaactagggtttatattttggtttgattaggattacgtcattagacttatccaacaatc |
1993607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 17050954 - 17050889
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| || ||||||||| | | |||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
17050954 |
ttatataaaattaaggtttatggcttggtttgattaggattatgtcattagatttatccaacaatc |
17050889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 17209805 - 17209753
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagac |
70 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| |||||||||| |
|
|
| T |
17209805 |
ttatataaaattagggtttatggtttggtttgattaggattacgtcattagac |
17209753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 83
Target Start/End: Original strand, 34053507 - 34053546
Alignment:
| Q |
44 |
gatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34053507 |
gatttgattaggattatgtcattagacttatccaacaatc |
34053546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 4366055 - 4366001
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| ||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4366055 |
tagggtttaaagtttggtttgattaggattatgtcattagacttatccaacaatc |
4366001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 4383584 - 4383530
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| ||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4383584 |
tagggtttaaagtttggtttgattaggattatgtcattagacttatccaacaatc |
4383530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 11399090 - 11399036
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11399090 |
tagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
11399036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 25055228 - 25055174
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25055228 |
tagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
25055174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 1998831 - 1998766
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||||||||||||| || | |||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
1998831 |
ttatttaaaactagggtttatattttggtttgattaggattacgtcattagacttatccaataatc |
1998766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 2781437 - 2781400
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2781437 |
tttgattaggattatgtcattagacttatccaacaatc |
2781400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 3280029 - 3279992
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3280029 |
tttgattaggattatgtcattagacttatccaacaatc |
3279992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 3338644 - 3338681
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3338644 |
tttgattaggattatgtcattagacttatccaacaatc |
3338681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 4768911 - 4768948
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4768911 |
tttgattaggattatgtcattagacttatccaacaatc |
4768948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 4830244 - 4830207
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4830244 |
tttgattaggattatgtcattagacttatccaacaatc |
4830207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 6710235 - 6710198
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6710235 |
tttgattaggattatgtcattagacttatccaacaatc |
6710198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 6809856 - 6809819
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6809856 |
tttgattaggattatgtcattagacttatccaacaatc |
6809819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 6815678 - 6815641
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6815678 |
tttgattaggattatgtcattagacttatccaacaatc |
6815641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 9360378 - 9360415
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9360378 |
tttgattaggattatgtcattagacttatccaacaatc |
9360415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 9365895 - 9365932
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9365895 |
tttgattaggattatgtcattagacttatacaacaatc |
9365932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 12246995 - 12246958
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12246995 |
tttgattaggattatgtcattagacttatccaacaatc |
12246958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 13087712 - 13087675
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13087712 |
tttgattaggattatgtcattagacttatccaacaatc |
13087675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 13093861 - 13093898
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13093861 |
tttgattaggattatgtcattagacttatccaacaatc |
13093898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 13098502 - 13098465
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13098502 |
tttgattaggattatgtcattagacttatccaacaatc |
13098465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14071611 - 14071648
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14071611 |
tttgattaggattatgtcattagacttatccaacaatc |
14071648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14137628 - 14137665
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14137628 |
tttgattaggattatgtcattagacttatacaacaatc |
14137665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 15425065 - 15425102
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15425065 |
tttgattaggattatgtcattagacttatccaacaatc |
15425102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 15430047 - 15430010
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15430047 |
tttgattaggattatgtcattagacttatccaacaatc |
15430010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 15854398 - 15854361
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15854398 |
tttgattaggattatgtcattagacttatccaacaatc |
15854361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 16034269 - 16034232
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16034269 |
tttgattaggattatgtcattagacttatccaacaatc |
16034232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 16385352 - 16385389
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16385352 |
tttgattaggattatgtcattagacttatccaacaatc |
16385389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 17041913 - 17041876
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17041913 |
tttgattaggattatgtcattagacttatccaacaatc |
17041876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 22164617 - 22164654
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22164617 |
tttgattaggattatgtcattagacttatccaacaatc |
22164654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 22169921 - 22169958
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22169921 |
tttgattaggattatgtcattagacttatccaacaatc |
22169958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 24697048 - 24697011
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24697048 |
tttgattaggattatgtcattagacttatccaacaatc |
24697011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 25765730 - 25765767
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25765730 |
tttgattaggattatgtcattagacttatccaacaatc |
25765767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 41473114 - 41473077
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41473114 |
tttgattaggattatgtcattagacttatccaacaatc |
41473077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 43496392 - 43496355
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43496392 |
tttgattaggattatgtcattagacttatccaacaatc |
43496355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 43841961 - 43841998
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43841961 |
tttgattaggattatgtcattagacttatccaacaatc |
43841998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 53354699 - 53354736
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53354699 |
tttgattaggattatgtcattagacttatccaacaatc |
53354736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 82
Target Start/End: Complemental strand, 13605234 - 13605198
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13605234 |
tttgattaggattatgtcattagacttatccaacaat |
13605198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 14445145 - 14445181
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14445145 |
ttgattaggattatgtcattagacttatccaacaatc |
14445181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 14457192 - 14457228
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14457192 |
ttgattaggattatgtcattagacttatccaacaatc |
14457228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 11827276 - 11827343
Alignment:
| Q |
16 |
agttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||| |||||| ||||||||| | | | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
11827276 |
agttacataaaattagggtttaaagcttggtttgattaggattacgtcattagacttatccaacaatc |
11827343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 19566875 - 19566929
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| || | | ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
19566875 |
tagggtttaaggcttggtttgattaggattatgtaattagacttatccaacaatc |
19566929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 2006145 - 2006108
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
2006145 |
tttgattatgattatgtcattagacttatccaacaatc |
2006108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 2722128 - 2722091
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
2722128 |
tttgattaggattatgtcaatagacttatccaacaatc |
2722091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 6829560 - 6829597
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
6829560 |
tttgattaggattgtgtcattagacttatccaacaatc |
6829597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14660690 - 14660727
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
14660690 |
tttgattaggattatgtcattagacttatccaaaaatc |
14660727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14866959 - 14866996
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
14866959 |
tttgattaggattatgtcattagacttatccaaaaatc |
14866996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 16334256 - 16334219
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
16334256 |
tttgattagggttatgtcattagacttatccaacaatc |
16334219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 17023445 - 17023408
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
17023445 |
tttgattaggattaggtcattagacttatccaacaatc |
17023408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 17480663 - 17480626
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
17480663 |
tttgattaggattatgtcattggacttatccaacaatc |
17480626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 20556250 - 20556213
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
20556250 |
tttgattaggattatgtcattagacttatccaataatc |
20556213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 22039037 - 22039000
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
22039037 |
tttgattaggattaggtcattagacttatccaacaatc |
22039000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 36076388 - 36076351
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
36076388 |
tttgattaggattatgtcattaaacttatccaacaatc |
36076351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 47975020 - 47974983
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
47975020 |
tttgattaggattatatcattagacttatccaacaatc |
47974983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 13068980 - 13068944
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
13068980 |
ttgattaggactatgtcattagacttatccaacaatc |
13068944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 46)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 4741205 - 4741140
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
4741205 |
ttatataaaattagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
4741140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 20105495 - 20105560
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
20105495 |
ttatataaaactagggtttatggtttggtttgattaggattacgtcattaaacttatccaacaatc |
20105560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 26138882 - 26138817
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
26138882 |
ttatataaaattagggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
26138817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 20218341 - 20218406
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||| | | |||||||||||||||||||||||||| || |||||||| |
|
|
| T |
20218341 |
ttatataaaattagggtttatggcttggtttgattaggattatgtcattagactcatccaacaatc |
20218406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 22112366 - 22112431
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||| | | |||||||||||||||||||||||||| || |||||||| |
|
|
| T |
22112366 |
ttatataaaattagggtttatggcttggtttgattaggattatgtcattagactcatccaacaatc |
22112431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 8603721 - 8603655
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8603721 |
gttacataaaattagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
8603655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 14992141 - 14992203
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaaca |
80 |
Q |
| |
|
|||||||||| ||||||||| | | ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14992141 |
ttatataaaattagggtttaaagcttgatttgattaggattatgtcattagacttatccaaca |
14992203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 25949543 - 25949477
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25949543 |
gttacataaaattagggtttaaggcttgctttgattaggattatgtcattagacttatccaacaatc |
25949477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 25507810 - 25507745
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||| ||||||| | |||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
25507810 |
ttatataaaattagggtgtatggtttggtttgattaggattacgtcattaaacttatccaacaatc |
25507745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 26018179 - 26018114
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
26018179 |
ttatataaaattagggtttatggtttggtttgattaggattacatcactagacttatccaacaatc |
26018114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 26157552 - 26157487
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
26157552 |
ttatataaaattagggtttatggtttggtttgattaggattacatcactagacttatccaacaatc |
26157487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 29254204 - 29254139
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||| || |||||||||||||| | |||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
29254204 |
ttatatataattagggtttatggtttggtttgattaggattacgtcattagatttatccaacaatc |
29254139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 1626372 - 1626306
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1626372 |
gttacataaaattagggtttaaggcttggcttgattaggattatgtcattagacttatccaacaatc |
1626306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 6795162 - 6795096
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | ||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
6795162 |
gttacataaaattagggtttaaggcttggtttgattaggattatgtcatttgacttatccaacaatc |
6795096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 20993648 - 20993702
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||| || ||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20993648 |
tagggttaatagtttggtttgattaggattatgtcattagacttatccaacaatc |
20993702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 21559979 - 21560045
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| |||| |||||| || | || ||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
21559979 |
gttatataatactaaggtttaaggcttgacttgatcaggattatgtcattagacttatccaacaatc |
21560045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 22601218 - 22601284
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| ||| | |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
22601218 |
gttacataaaattagggtttaaagtttggtttgattatgattatgtcattagacttatccaacaatc |
22601284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 25964137 - 25964071
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| || |||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25964137 |
gttacataaaattatggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
25964071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 25968784 - 25968718
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| || |||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25968784 |
gttacataaaattatggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
25968718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 4188333 - 4188296
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4188333 |
tttgattaggattatgtcattagacttatccaacaatc |
4188296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 5399445 - 5399384
Alignment:
| Q |
22 |
ataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||| ||||||||| || | | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
5399445 |
ataaaattagggtttaaggcttggtttgattaggattacgtcattagacttatccaacaatc |
5399384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 15700374 - 15700337
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15700374 |
tttgattaggattatgtcattagacttatccaacaatc |
15700337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 17743695 - 17743658
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17743695 |
tttgattaggattatgtcattagacttatccaacaatc |
17743658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 19075242 - 19075279
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19075242 |
tttgattaggattatgtcattagacttatccaacaatc |
19075279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 19615090 - 19615127
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19615090 |
tttgattaggattatgtcattagacttatccaacaatc |
19615127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 22005957 - 22005920
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22005957 |
tttgattaggattatgtcattagacttatccaacaatc |
22005920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 22060910 - 22060947
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22060910 |
tttgattaggattatgtcattagacttatccaacaatc |
22060947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 22071991 - 22072028
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22071991 |
tttgattaggattatgtcattagacttatccaacaatc |
22072028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 24545492 - 24545545
Alignment:
| Q |
30 |
agggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||| | |||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
24545492 |
agggtttatggtttggtttgattaggattacgttattagacttatccaacaatc |
24545545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 25786260 - 25786297
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25786260 |
tttgattaggattatgtcattagacttatccaacaatc |
25786297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 18448966 - 18448930
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18448966 |
ttgattaggattatgtcattagacttatccaacaatc |
18448930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 19966546 - 19966582
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19966546 |
ttgattaggattatgtcattagacttatccaacaatc |
19966582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 81
Target Start/End: Original strand, 12657216 - 12657251
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12657216 |
tttgattaggattatgtcattagacttatccaacaa |
12657251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 12474439 - 12474476
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
12474439 |
tttgattagaattatgtcattagacttatccaacaatc |
12474476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 16470167 - 16470130
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
16470167 |
tttgattaagattatgtcattagacttatccaacaatc |
16470130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 17283947 - 17283984
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
17283947 |
tttgattaggattatggcattagacttatccaacaatc |
17283984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 18184299 - 18184340
Alignment:
| Q |
46 |
tttgattaggattatgtca-ttagacttatgcaacaatcgca |
86 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
18184299 |
tttgattaggattatgtcatttagacttatccaacaatcgca |
18184340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 18233715 - 18233752
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
18233715 |
tttgattatgattatgtcattagacttatccaacaatc |
18233752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 22738030 - 22737993
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
22738030 |
tttgattaggattatgttattagacttatccaacaatc |
22737993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 23297284 - 23297349
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||| || |||| |||||| || | || ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
23297284 |
ttatacaatactaaggtttaaggcttgacttgattacgattatgtcattagacttatccaacaatc |
23297349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 25339131 - 25339168
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
25339131 |
tttgattaggattatgtcattaaacttatccaacaatc |
25339168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 26474143 - 26474106
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
26474143 |
tttgattaggattatatcattagacttatccaacaatc |
26474106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 27565743 - 27565780
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
27565743 |
tttgattaggattatgtcattagaattatccaacaatc |
27565780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 32543431 - 32543394
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
32543431 |
tttgattaggattatgtcattagacttatccaccaatc |
32543394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 12442705 - 12442665
Alignment:
| Q |
44 |
gatttgattaggattatgtca-ttagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
12442705 |
gatttgattaggattatgtcatttagacttatccaacaatc |
12442665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 18732537 - 18732497
Alignment:
| Q |
44 |
gatttgattaggattatgtcatt-agacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
18732537 |
gatttgattaggattatgtcattaagacttatccaacaatc |
18732497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 35)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 30949124 - 30949180
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttat |
74 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
30949124 |
ttatataaaactagggtttatggtttggtttgattaggattacgtcattagacttat |
30949180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 23698676 - 23698741
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||| ||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
23698676 |
ttatataaaattagggtttatagtttggtttgattaggattacgtcattagacttatccaacaatc |
23698741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 24366172 - 24366237
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| || ||||||||||| | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
24366172 |
ttatataaaattaaggtttatggtttggtttgattaggattacgtcattagacttatccaacaatc |
24366237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 25858456 - 25858521
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||| | |||||||||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25858456 |
ttatataatattagggtttatggtttgatttgattaggattacgtcattagacttatcgaacaatc |
25858521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 41653480 - 41653545
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
41653480 |
ttatataaaattagggtttatggtttggtttgattaggattacatcattagacttatccaacaatc |
41653545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 23340787 - 23340721
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23340787 |
gttacataaaattagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
23340721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 28496562 - 28496628
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||| ||||||||| | | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28496562 |
gttatataaaattagggtttaaagcttggtttgattaggattatgtcattagacttatccaacaatc |
28496628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 15584057 - 15583992
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| ||||||| | || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15584057 |
ttatataaaattagggttcaaggcttggtttgattaggattatgtcattagacttattcaacaatc |
15583992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 11044 - 11084
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatcgca |
86 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11044 |
tttgattaggattatgtcattagacttatccaacaatcgca |
11084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 20172713 - 20172750
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20172713 |
tttgattaggattatgtcattagacttatccaacaatc |
20172750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 20282238 - 20282201
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20282238 |
tttgattaggattatgtcattagacttatccaacaatc |
20282201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 21468345 - 21468382
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21468345 |
tttgattaggattatgtcattagacttatccaacaatc |
21468382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 22328712 - 22328647
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||| | ||| | |||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
22328712 |
ttatataaaattagggttttttgtttggtttgattaggataacgtcattagacttatccaacaatc |
22328647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 23139896 - 23139933
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23139896 |
tttgattaggattatgtcattagacttatccaacaatc |
23139933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 23551686 - 23551723
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23551686 |
tttgattaggattatgtcattagacttatccaacaatc |
23551723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 24507496 - 24507459
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24507496 |
tttgattaggattatgtcattagacttatccaacaatc |
24507459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 25043008 - 25043045
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25043008 |
tttgattaggattatgtcattagacttatccaacaatc |
25043045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 25358328 - 25358291
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25358328 |
tttgattaggattatgtcattagacttatccaacaatc |
25358291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 25370235 - 25370272
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25370235 |
tttgattaggattatgtcattagacttatccaacaatc |
25370272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 27745257 - 27745220
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27745257 |
tttgattaggattatgtcattagacttatccaacaatc |
27745220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 29577242 - 29577279
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29577242 |
tttgattaggattatgtcattagacttatccaacaatc |
29577279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 36684488 - 36684451
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36684488 |
tttgattaggattatgtcattagacttatccaacaatc |
36684451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 21344355 - 21344415
Alignment:
| Q |
23 |
taaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||| ||||||||| || | | |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
21344355 |
taaaattagggtttaaggcttggtttgattaggattacgtcattagacttatccaacaatc |
21344415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 24172185 - 24172149
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24172185 |
ttgattaggattatgtcattagacttatccaacaatc |
24172149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 25144155 - 25144191
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25144155 |
ttgattaggattatgtcattagacttatccaacaatc |
25144191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 33181868 - 33181832
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33181868 |
ttgattaggattatgtcattagacttatccaacaatc |
33181832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 48 - 83
Target Start/End: Complemental strand, 20635851 - 20635816
Alignment:
| Q |
48 |
tgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20635851 |
tgattaggattatgtcattagacttatccaacaatc |
20635816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 11391330 - 11391264
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||| ||| ||| | ||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
11391330 |
gttacataaaattaggggttaaagtttggtttgattaggattatgtcattggacttatccaacaatc |
11391264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 11407991 - 11407925
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||| ||| ||| | ||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
11407991 |
gttacataaaattaggggttaaagtttggtttgattaggattatgtcattggacttatccaacaatc |
11407925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 23704500 - 23704434
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | | ||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
23704500 |
gttacataaaattagggtttagagcttggtttgattagtattatgtcattagacttatccaacaatc |
23704434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 24177573 - 24177610
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
24177573 |
tttgattaggattatgtcattagacttatccatcaatc |
24177610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 25803694 - 25803731
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
25803694 |
tttgattaggattatatcattagacttatccaacaatc |
25803731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 32140162 - 32140125
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
32140162 |
tttgattaggattatgtcattagacttctccaacaatc |
32140125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 35080786 - 35080749
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
35080786 |
tttgattaggattatgtcattagacttatccaataatc |
35080749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 11318090 - 11318126
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
11318090 |
ttgattaggattatgtcattagacctatccaacaatc |
11318126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0713 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0713
Description:
Target: scaffold0713; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 6573 - 6638
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
6573 |
ttatataaaattagggtttatggtttggtttgattaggattacgtcattaggcttatccaacaatc |
6638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0264 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0264
Description:
Target: scaffold0264; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 22291 - 22356
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
22291 |
ttatataaaattagggtttatggtttggtttgattaggattacgtcattagacttatccatcaatc |
22356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1092 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold1092
Description:
Target: scaffold1092; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 1548 - 1614
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1548 |
gttacataaaattagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
1614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1058 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold1058
Description:
Target: scaffold1058; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 2925 - 2991
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| || | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2925 |
gttacataaaattagggtttaaggcttggtttgattaggattatgtcattagacttatccaacaatc |
2991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0362 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0362
Description:
Target: scaffold0362; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 9088 - 9153
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| ||| |||||||||| | |||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
9088 |
ttatataaaattagagtttatggtttggtttgattaggattacgtcattagatttatccaacaatc |
9153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0084 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0084
Description:
Target: scaffold0084; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 49915 - 49850
Alignment:
| Q |
18 |
ttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
49915 |
ttatataaaattagggtttatggtttagtttgattaggattacgtcattagacttatccaaaaatc |
49850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0566 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0566
Description:
Target: scaffold0566; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 3414 - 3375
Alignment:
| Q |
44 |
gatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3414 |
gatttgattaggattatgtcattagacttatccaacaatc |
3375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0197 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 8693 - 8759
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8693 |
gttacataaaattagggtttaagacttggtttgattaggattatgtcattagacttatccaacaatc |
8759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0150 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0150
Description:
Target: scaffold0150; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 19586 - 19520
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| | || |||||| || | || |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19586 |
gttatataatattaaggtttaaggcttgacttgattaggattatgtcattagacttattcaacaatc |
19520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0150; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 26415 - 26349
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| | || |||||| || | || |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26415 |
gttatataatattaaggtttaaggcttgacttgattaggattatgtcattagacttattcaacaatc |
26349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 78051 - 77985
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||| |||||| ||||||||| | | | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
78051 |
gttacataaaattagggtttaaagcttggtttgattaggattatgtcattagacttatccaacaatc |
77985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0916 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0916
Description:
Target: scaffold0916; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 3708 - 3671
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3708 |
tttgattaggattatgtcattagacttatccaacaatc |
3671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0816 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0816
Description:
Target: scaffold0816; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 1228 - 1265
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1228 |
tttgattaggattatgtcattagacttatccaacaatc |
1265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0773 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0773
Description:
Target: scaffold0773; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 1310 - 1273
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1310 |
tttgattaggattatgtcattagacttattcaacaatc |
1273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0673 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0673
Description:
Target: scaffold0673; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 3112 - 3149
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3112 |
tttgattaggattatgtcattagacttatccaacaatc |
3149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0607 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0607
Description:
Target: scaffold0607; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 9699 - 9662
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9699 |
tttgattaggattatgtcattagacttatccaacaatc |
9662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0560 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0560
Description:
Target: scaffold0560; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 1969 - 1932
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1969 |
tttgattaggattatgtcattagacttatccaacaatc |
1932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0489 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0489
Description:
Target: scaffold0489; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 862 - 825
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
862 |
tttgattaggattatgtcattagacttatccaacaatc |
825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 8928 - 8891
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8928 |
tttgattaggattatgtcattagacttatccaacaatc |
8891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 16454 - 16417
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16454 |
tttgattaggattatgtcattagacttatccaacaatc |
16417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0215 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0215
Description:
Target: scaffold0215; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 37 - 74
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37 |
tttgattaggattatgtcattagacttatccaacaatc |
74 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0211 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0211
Description:
Target: scaffold0211; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 17546 - 17583
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17546 |
tttgattaggattatgtcattagacttatccaacaatc |
17583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0146 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0146
Description:
Target: scaffold0146; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 38260 - 38223
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38260 |
tttgattaggattatgtcattagacttatccaacaatc |
38223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0111 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0111
Description:
Target: scaffold0111; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 34942 - 34979
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34942 |
tttgattaggattatgtcattagacttatccaacaatc |
34979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0075
Description:
Target: scaffold0075; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 19626 - 19589
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19626 |
tttgattaggattatgtcattagacttatccaacaatc |
19589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 32191 - 32228
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32191 |
tttgattaggattatgtcattagacttatccaacaatc |
32228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 37173 - 37136
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37173 |
tttgattaggattatgtcattagacttatccaacaatc |
37136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 21370 - 21333
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21370 |
tttgattaggattatgtcattagacttatccaacaatc |
21333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 14476 - 14513
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14476 |
tttgattaggattatgtcattagacttatccaacaatc |
14513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 49924 - 49961
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49924 |
tttgattaggattatgtcattagacttatccaacaatc |
49961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 117963 - 117926
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
117963 |
tttgattaggattatgtcattagacttatccaacaatc |
117926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 117945 - 117908
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
117945 |
tttgattaggattatgtcattagacttatccaacaatc |
117908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 124189 - 124152
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
124189 |
tttgattaggattatgtcattagacttatccaacaatc |
124152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 33279 - 33316
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33279 |
tttgattaggattatgtcattagacttatccaacaatc |
33316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 369408 - 369445
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
369408 |
tttgattaggattatgtcattagacttatccaacaatc |
369445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0861 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0861
Description:
Target: scaffold0861; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 1583 - 1547
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1583 |
ttgattaggattatgtcattagacttatccaacaatc |
1547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0630 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0630
Description:
Target: scaffold0630; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 5629 - 5593
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5629 |
ttgattaggattatgtcattagacttatccaacaatc |
5593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0261 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0261
Description:
Target: scaffold0261; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 4970 - 4934
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4970 |
ttgattaggattatgtcattagacttatccaacaatc |
4934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 21564 - 21600
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21564 |
ttgattaggattatgtcattagacttatccaacaatc |
21600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0165 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0165
Description:
Target: scaffold0165; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 19045 - 19009
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19045 |
ttgattaggattatgtcattagacttatccaacaatc |
19009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 81
Target Start/End: Complemental strand, 23372 - 23308
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaa |
81 |
Q |
| |
|
||||||||| |||| |||||| || | || || ||||||||||||||||||||||||| |||||| |
|
|
| T |
23372 |
gttatataatactaaggtttaaggcttgacttaattaggattatgtcattagacttatccaacaa |
23308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 84139 - 84175
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
84139 |
ttgattaggattatgtcattagacttatccaacaatc |
84175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 72
Target Start/End: Complemental strand, 50097 - 50049
Alignment:
| Q |
24 |
aaaactagggtttatggttcgatttgattaggattatgtcattagactt |
72 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
50097 |
aaaattagggtttatggtttggtttgattaggattacgtcattagactt |
50049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 159260 - 159224
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
159260 |
ttgattaggattatgtcattagacttatccaacaatc |
159224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 83
Target Start/End: Original strand, 424917 - 424957
Alignment:
| Q |
44 |
gatttgattaggattatgtca-ttagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
424917 |
gatttgattaggattatgtcatttagacttatccaacaatc |
424957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0674 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0674
Description:
Target: scaffold0674; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 48 - 83
Target Start/End: Original strand, 1688 - 1723
Alignment:
| Q |
48 |
tgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1688 |
tgattaggattatgtcattagacttatccaacaatc |
1723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 44 - 83
Target Start/End: Original strand, 44187 - 44226
Alignment:
| Q |
44 |
gatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
44187 |
gatttgattacgattatgtcattagacttatccaacaatc |
44226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0192 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0192
Description:
Target: scaffold0192; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 4749 - 4683
Alignment:
| Q |
17 |
gttatataaaactagggtttatggttcgatttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||| |||| |||||| || | || ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
4749 |
gttatataatactaaggtttaaggcttgacttgattaggattacatcattagacttatccaacaatc |
4683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0624 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0624
Description:
Target: scaffold0624; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 4871 - 4834
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
4871 |
tttgattaggattacgtcattagacttatccaacaatc |
4834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0278 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0278
Description:
Target: scaffold0278; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 74
Target Start/End: Original strand, 12421 - 12466
Alignment:
| Q |
29 |
tagggtttatggttcgatttgattaggattatgtcattagacttat |
74 |
Q |
| |
|
||||||||| || | | ||||||||||||||||||||||||||||| |
|
|
| T |
12421 |
tagggtttaaggcttggtttgattaggattatgtcattagacttat |
12466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 21791 - 21754
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
21791 |
tttgattaggattatgtcattagatttatccaacaatc |
21754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Original strand, 8749 - 8786
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8749 |
tttgattaggattatgtcattagacttatcaaacaatc |
8786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0471 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0471
Description:
Target: scaffold0471; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 9717 - 9753
Alignment:
| Q |
47 |
ttgattaggattatgtcattagacttatgcaacaatc |
83 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
9717 |
ttgattaggattatatcattagacttatccaacaatc |
9753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0125 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0125
Description:
Target: scaffold0125; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 74
Target Start/End: Complemental strand, 42895 - 42867
Alignment:
| Q |
46 |
tttgattaggattatgtcattagacttat |
74 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42895 |
tttgattaggattatgtcattagacttat |
42867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University