View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14309_low_25 (Length: 255)
Name: NF14309_low_25
Description: NF14309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14309_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 64 - 240
Target Start/End: Complemental strand, 32117226 - 32117051
Alignment:
| Q |
64 |
ttaattgatttgatgctctagaatgtcttaattttatatttgaatgtgtgttataaccttgatatttttctagacattaagctttttgatgagaataaag |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32117226 |
ttaattgatttgatgctctagaatgtcttaattttatatttgaatgtatgttataaccttgatatttttctagacattaagctttttgatgagaataaag |
32117127 |
T |
 |
| Q |
164 |
cgacggatagagttctaannnnnnnnatcctgtgagagtttcttcttctaagaagatggaatgagaagcaaatatgt |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32117126 |
cgacggatagagttctaa-tttttttatcctgtgagagtttcttcttctaagaagatggaatgagaagcaaatatgt |
32117051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 32118229 - 32118180
Alignment:
| Q |
1 |
tagcttaactagtagcaataagaagggataattaataaaactatatatat |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32118229 |
tagcttaactagtagcaataagaagggataattaataaaactatatatat |
32118180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University