View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1430_high_13 (Length: 292)

Name: NF1430_high_13
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1430_high_13
NF1430_high_13
[»] chr4 (1 HSPs)
chr4 (128-258)||(440695-440814)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 128 - 258
Target Start/End: Original strand, 440695 - 440814
Alignment:
128 ttcctgaaacgtgttgaagcctctgggatgtctgtatgaatggctgataaaagaagaattgaacgctttgatcagaaataatacagcagatatacagaaa 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||           |||||||||    
440695 ttcctgaaacgtgttgaagcctctgggatgtctgtatgaatggctgataaaagaacaattgaacgcattgatcagaaata-----------atacagaaa 440783  T
228 aggatgttttgagctttatggagaaaaggga 258  Q
    |||||||||||||||||||||||||||||||    
440784 aggatgttttgagctttatggagaaaaggga 440814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University