View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_high_24 (Length: 228)
Name: NF1430_high_24
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 24814171 - 24814393
Alignment:
| Q |
1 |
cttaggttatatatattgggaaatgagtaatctttcactagcatgttttctgcatcaaaaataagattggttggatttgtataaatgtatctccaattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24814171 |
cttaggttatatatattgggaaatgagtaatctttcactagcatgttttctgcatcaaaaataagattggttggatttgtataaatgtatctccaattgg |
24814270 |
T |
 |
| Q |
101 |
aagatagaacactggttttgacagcttcattgatcttaagagaagataaaatgttgctcaataaactatagggtagtgtactaatataatcatgattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24814271 |
aagatagaacactggttttgacagcttcattgatcttaagggaagataaaatgttgctcaataaactatagggtagtgtactaatataatcatgattatt |
24814370 |
T |
 |
| Q |
201 |
tctttcctctaccctttgcttct |
223 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
24814371 |
tctttcctctaccctttgtttct |
24814393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University