View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_low_18 (Length: 305)
Name: NF1430_low_18
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_low_18 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 195 - 305
Target Start/End: Complemental strand, 40577793 - 40577683
Alignment:
| Q |
195 |
ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40577793 |
ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg |
40577694 |
T |
 |
| Q |
295 |
ttactgtgttc |
305 |
Q |
| |
|
||||||||||| |
|
|
| T |
40577693 |
ttactgtgttc |
40577683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 54
Target Start/End: Complemental strand, 40577977 - 40577934
Alignment:
| Q |
11 |
cataggcaagttgagcttctttctccgatcccaaaaccaccttc |
54 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40577977 |
catagacaagttgagcttctttctccgatcccaaaaccaccttc |
40577934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 266
Target Start/End: Complemental strand, 734308 - 734268
Alignment:
| Q |
226 |
aaagttcacatgcattgtgaagcttgttcacaagaaatcaa |
266 |
Q |
| |
|
||||||||||||||||||||||||||| || | |||||||| |
|
|
| T |
734308 |
aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa |
734268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 266
Target Start/End: Complemental strand, 45390701 - 45390661
Alignment:
| Q |
226 |
aaagttcacatgcattgtgaagcttgttcacaagaaatcaa |
266 |
Q |
| |
|
||||||||||||||||||||||||||| || | |||||||| |
|
|
| T |
45390701 |
aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa |
45390661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University