View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_low_19 (Length: 292)
Name: NF1430_low_19
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 128 - 258
Target Start/End: Original strand, 440695 - 440814
Alignment:
| Q |
128 |
ttcctgaaacgtgttgaagcctctgggatgtctgtatgaatggctgataaaagaagaattgaacgctttgatcagaaataatacagcagatatacagaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
440695 |
ttcctgaaacgtgttgaagcctctgggatgtctgtatgaatggctgataaaagaacaattgaacgcattgatcagaaata-----------atacagaaa |
440783 |
T |
 |
| Q |
228 |
aggatgttttgagctttatggagaaaaggga |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
440784 |
aggatgttttgagctttatggagaaaaggga |
440814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University