View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_low_21 (Length: 269)
Name: NF1430_low_21
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 23 - 253
Target Start/End: Complemental strand, 51510136 - 51509906
Alignment:
| Q |
23 |
aatatctatgaaattaatgaaattattaagaaataggcttgtaatttcactaaaacaataaattgatggatcatggaatattgaaaatgttatggcattg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51510136 |
aatatctatgaaattaatgaaattattaagaaataggcttgtaatttcactaaaacaataaattgatggatcatggaatattgaaaatgttatggcattg |
51510037 |
T |
 |
| Q |
123 |
ttgcttttgagatgcctaacaagtatcctgaactttgcctcatgtattttgtctaataggaaacaaatcaagcaaggcatggatcaaaaagaattttcca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51510036 |
ttgcttttgagatgcctaacaagtatcctgaactttgcctcatgtattttgtttaataggaaacaaatcaagcaaggcatggatcaaaaagaattttcca |
51509937 |
T |
 |
| Q |
223 |
agtctatggttgtatagtgactgctcaagac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51509936 |
agtctatggttgtatagtgactgctcaagac |
51509906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University