View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_low_22 (Length: 268)
Name: NF1430_low_22
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 3 - 256
Target Start/End: Original strand, 7090076 - 7090329
Alignment:
| Q |
3 |
atagatatatgatacacctatggttcatcacacatgggtttcaacaagtgacaaatttgccaccccattatgacttataacacttttgtccaaaacaaaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7090076 |
atagatatatgatacacctatggttcatcacacatgggtttcaacaagtgacaaatttgccaccccattatgacttacaacacttttgtccaaaacaaaa |
7090175 |
T |
 |
| Q |
103 |
ggctttgtcgtgtcttggaacctcttgctatgtccttgtgattttaatatatgttggtatgcactttttaacaattttgtgtacattgattcaaaataat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7090176 |
ggctttgtcgtgtcttggaacctcttgctatgtccttgtgattttaatatatgttggtatgcactttttaacaattttgtgtacattgattcaaaataat |
7090275 |
T |
 |
| Q |
203 |
aatgattttgtttacatgtatgttattgtttgatttatcatgaatgagtatttt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7090276 |
aatgattttgtttacatgtatgttattgtttgatttatcatgaatgagtatttt |
7090329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University