View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1430_low_24 (Length: 250)

Name: NF1430_low_24
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1430_low_24
NF1430_low_24
[»] chr4 (2 HSPs)
chr4 (8-75)||(39197341-39197408)
chr4 (167-208)||(39197500-39197541)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 39197341 - 39197408
Alignment:
8 agtgttatgaacattttctttttaagattcttttcaatattcacttttttattaatacaactcattga 75  Q
    ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||    
39197341 agtgttatgaacattttttttttaagattcttttcaatactcacttttttattaatacaactcattga 39197408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 39197500 - 39197541
Alignment:
167 taaggaaagagcgttcttagcatatttctcttttgtttaatg 208  Q
    |||||||||||||||||||||||||||||| |||||||||||    
39197500 taaggaaagagcgttcttagcatatttctcatttgtttaatg 39197541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University