View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_low_24 (Length: 250)
Name: NF1430_low_24
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 39197341 - 39197408
Alignment:
| Q |
8 |
agtgttatgaacattttctttttaagattcttttcaatattcacttttttattaatacaactcattga |
75 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39197341 |
agtgttatgaacattttttttttaagattcttttcaatactcacttttttattaatacaactcattga |
39197408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 39197500 - 39197541
Alignment:
| Q |
167 |
taaggaaagagcgttcttagcatatttctcttttgtttaatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39197500 |
taaggaaagagcgttcttagcatatttctcatttgtttaatg |
39197541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University