View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_low_25 (Length: 242)
Name: NF1430_low_25
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 131 - 226
Target Start/End: Original strand, 5188887 - 5188983
Alignment:
| Q |
131 |
cccatcaagtaattagtgaatttgtggtcaaaaagactcacaaaaacaaatggcatagcaccat-aagtatgatatagaataaagactgcaaaactg |
226 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
5188887 |
cccatcaagtaattagcgaatttgtggtcaaaaagactcacaaaaacaaatggcatagcaccatcaagtatgatatagagcaaagactgcaaaactg |
5188983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 5188778 - 5188854
Alignment:
| Q |
13 |
agcaaaggctctcaaatttatgccttgggatgttttcaagttgaaggaattgttcttggatgttatccaatttcaag |
89 |
Q |
| |
|
|||| |||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5188778 |
agcagaggcgctcaaatttatgccttaagatgttttcaagttgaaggaattgtgcttggatgttatccaatttcaag |
5188854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University