View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_low_28 (Length: 238)
Name: NF1430_low_28
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 42 - 218
Target Start/End: Complemental strand, 21271269 - 21271094
Alignment:
| Q |
42 |
aggatgaggcatttatttaaaaattgaaagatgcagaaattttcaacgtttataatttttcctcctttgattgatacttgtgtgattatcatttgccgga |
141 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21271269 |
aggatgaggcatttatttaaaaatggaaagatgcagaaattttcaacgttg-taatttttcctcctttgattgatacttgtgtgattatcatttgccgca |
21271171 |
T |
 |
| Q |
142 |
attttttaagttgcatcatgcgcaattctgttctttaggattttgaaccttctttatcagtgattgtccgaaagtac |
218 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
21271170 |
cttttgtaagttgcatcatgtgcaattctgttctttaggattttgaaccttgtttctcagtgattgtccgaaagtac |
21271094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University